Peroxisome Proliferator-activated Receptor (PPAR)-2 Controls Adipocyte Differentiation and Adipose Tissue Function through the Regulation of the Activity of the Retinoid X Receptor/PPARγ Heterodimer

Abstract

The peroxisome proliferator-activated receptor-γ (PPARγ, NR1C3) in complex with the retinoid X receptor (RXR) plays a central role in white adipose tissue (WAT) differentiation and function, regulating the expression of key WAT proteins. In this report we show that poly(ADP-ribose) polymerase-2 (PARP-2), also known as an enzyme participating in the surveillance of the genome integrity, is a member of the PPARγ/RXR transcription machinery. PARP-2-/- mice accumulate less WAT, characterized by smaller adipocytes. In the WAT of PARP-2-/- mice the expression of a number of PPARγ target genes is reduced despite the fact that PPARγ1 and -γ2 are expressed at normal levels. Consistent with this, PARP-2-/- mouse embryonic fibroblasts fail to differentiate to adipocytes. In transient transfection assays, PARP-2 small interference RNA decreases basal activity and ligand-dependent activation of PPARγ, whereas PARP-2 overexpression enhances the basal activity of PPARγ, although it does not change the maximal ligand-dependent activation. In addition, we show a DNA-dependent interaction of PARP-2 and PPARγ/RXR heterodimer by chromatin immunoprecipitation. In combination, our results suggest that PARP-2 is a novel cofactor of PPARγ activity. The peroxisome proliferator-activated receptor-γ (PPARγ, NR1C3) in complex with the retinoid X receptor (RXR) plays a central role in white adipose tissue (WAT) differentiation and function, regulating the expression of key WAT proteins. In this report we show that poly(ADP-ribose) polymerase-2 (PARP-2), also known as an enzyme participating in the surveillance of the genome integrity, is a member of the PPARγ/RXR transcription machinery. PARP-2-/- mice accumulate less WAT, characterized by smaller adipocytes. In the WAT of PARP-2-/- mice the expression of a number of PPARγ target genes is reduced despite the fact that PPARγ1 and -γ2 are expressed at normal levels. Consistent with this, PARP-2-/- mouse embryonic fibroblasts fail to differentiate to adipocytes. In transient transfection assays, PARP-2 small interference RNA decreases basal activity and ligand-dependent activation of PPARγ, whereas PARP-2 overexpression enhances the basal activity of PPARγ, although it does not change the maximal ligand-dependent activation. In addition, we show a DNA-dependent interaction of PARP-2 and PPARγ/RXR heterodimer by chromatin immunoprecipitation. In combination, our results suggest that PARP-2 is a novel cofactor of PPARγ activity. Adipose tissue is composed of adipocytes that store energy in the form of triglycerides. Excessive accumulation of white adipose tissue (WAT) 2The abbreviations used are: WATwhite adipose tissuePPARperoxisome proliferator-activated receptorPARP-1 and -2poly(ADP-ribose) polymerase-1 and -2TTF1thyroid transcription factor-1WTwild typeRT-qPCRreverse transcription-coupled quantitative PCRaP2adipocyte fatty acid-binding protein 2ERβestrogen receptor βK19keratin-19ChIPchromatin immunoprecipitationRXRretinoid X receptorHEK 293human embryonic kidney 293TNFαtumor necrosis factor αCREBcAMP-response element-binding proteinDMEMDulbecco's modified Eagle's mediumMEFmouse embryonic fibroblastsiRNAsmall interference RNABES2[bis(2-hydroxyethyl)amino]ethanesulfonic acid 2The abbreviations used are: WATwhite adipose tissuePPARperoxisome proliferator-activated receptorPARP-1 and -2poly(ADP-ribose) polymerase-1 and -2TTF1thyroid transcription factor-1WTwild typeRT-qPCRreverse transcription-coupled quantitative PCRaP2adipocyte fatty acid-binding protein 2ERβestrogen receptor βK19keratin-19ChIPchromatin immunoprecipitationRXRretinoid X receptorHEK 293human embryonic kidney 293TNFαtumor necrosis factor αCREBcAMP-response element-binding proteinDMEMDulbecco's modified Eagle's mediumMEFmouse embryonic fibroblastsiRNAsmall interference RNABES2[bis(2-hydroxyethyl)amino]ethanesulfonic acid leads to obesity, whereas its absence leads to lipodystrophic syndromes. The peroxisome proliferator-activated receptor-γ (PPARγ, NR1C3) is the main protein orchestrating the differentiation and function of WAT, as evidenced by the combination of in vitro studies, the analysis of mouse models, and the characterization of patients with mutations in the human PPARγ gene (1Gurnell M. Best Pract. Res. Clin. Endocrinol. Metab. 2005; 19: 501-523Crossref PubMed Scopus (70) Google Scholar, 2Knouff C. Auwerx J. Endocr. Rev. 2004; 25: 899-918Crossref PubMed Scopus (240) Google Scholar). PPARγ acts as heterodimer with the retinoid X receptor (RXR) (3Fajas L. Auboeuf D. Raspe E. Schoonjans K. Lefebvre A.M. Saladin R. Najib J. Laville M. Fruchart J.C. Deeb S. Vidal-Puig A. Flier J. Briggs M.R. Staels B. Vidal H. Auwerx J. J. Biol. Chem. 1997; 272: 18779-18789Abstract Full Text Full Text PDF PubMed Scopus (1075) Google Scholar). The PPARγ/RXR receptor dimer is involved in the transcriptional control of energy, lipid, and glucose homeostasis (4Evans R.M. Barish G.D. Wang Y.X. Nat. Med. 2004; 10: 355-361Crossref PubMed Scopus (1257) Google Scholar, 5Cock T.A. Houten S.M. Auwerx J. EMBO Rep. 2004; 5: 142-147Crossref PubMed Scopus (126) Google Scholar). The actions of PPARγ are mediated by two protein isoforms, the widely expressed PPARγ1 and adipose tissue-restricted PPARγ2, both produced from a single gene by alternative splicing and differing only by an additional 28 amino acids in the N terminus of PPARγ2 (3Fajas L. Auboeuf D. Raspe E. Schoonjans K. Lefebvre A.M. Saladin R. Najib J. Laville M. Fruchart J.C. Deeb S. Vidal-Puig A. Flier J. Briggs M.R. Staels B. Vidal H. Auwerx J. J. Biol. Chem. 1997; 272: 18779-18789Abstract Full Text Full Text PDF PubMed Scopus (1075) Google Scholar, 6Tontonoz P. Hu E. Graves R.A. Budavari A.I. Spiegelman B.M. Genes Dev. 1994; 8: 1224-1234Crossref PubMed Scopus (1981) Google Scholar).PPARγ is activated by binding of small lipophilic ligands, mainly fatty acids, derived from nutrition or metabolic pathways, or synthetic agonists, like the anti-diabetic thiazoli-denediones (2Knouff C. Auwerx J. Endocr. Rev. 2004; 25: 899-918Crossref PubMed Scopus (240) Google Scholar, 7Rosen E.D. Spiegelman B.M. J. Biol. Chem. 2001; 276: 37731-37734Abstract Full Text Full Text PDF PubMed Scopus (1068) Google Scholar, 8Lehrke M. Lazar M.A. Cell. 2005; 123: 993-999Abstract Full Text Full Text PDF PubMed Scopus (1135) Google Scholar). Docking of these ligands in the ligand binding pocket alters the conformation of PPARγ, resulting in transcriptional activation subsequent to the release of corepressors and the recruitment of coactivators. Many corepressors and coactivators have been described such as the nuclear receptor corepressor and the steroid receptor coactivators, also known as p160 proteins (9McKenna N.J. O'Malley B.W. Cell. 2002; 108: 465-474Abstract Full Text Full Text PDF PubMed Scopus (1233) Google Scholar, 10Rosenfeld M.G. Lunyak V.V. Glass C.K. Genes Dev. 2006; 20: 1405-1428Crossref PubMed Scopus (762) Google Scholar, 11Feige J.N. Auwerx J. Trends Cell Biol. 2007; 17: 292-301Abstract Full Text Full Text PDF PubMed Scopus (245) Google Scholar). These corepressors and coactivators determine transcriptional activity by altering chromatin structure via enzyme such as histone deacetylases and histone acetyltransferases (CREB-binding protein/p300). Other mechanisms include DNA methylation, ATP-dependent remodeling, protein phosphorylation, sumoylation, ubiquitinylation, and poly(ADP-ribosyl)ation.Poly(ADP-ribose) polymerase-2 (PARP-2) was described by Ame et al. (12Ame J.C. Rolli V. Schreiber V. Niedergang C. Apiou F. Decker P. Muller S. Hoger T. Menissier-de Murcia J. de Murcia G. J. Biol. Chem. 1999; 274: 17860-17868Abstract Full Text Full Text PDF PubMed Scopus (601) Google Scholar) in 1999 as a 66.2-kDa nuclear protein with poly-(ADP-ribosyl)ating activity. Through its DNA-binding domain in the N terminus (amino acids 1-62), PARP-2 can bind to DNase I-treated DNA and to aberrant DNA forms, and its subsequent activation results in poly(ADP-ribose) polymer formation (12Ame J.C. Rolli V. Schreiber V. Niedergang C. Apiou F. Decker P. Muller S. Hoger T. Menissier-de Murcia J. de Murcia G. J. Biol. Chem. 1999; 274: 17860-17868Abstract Full Text Full Text PDF PubMed Scopus (601) Google Scholar). According to the general scheme of PARP activation, the active enzyme catalyzes the polymerization of poly(ADP-ribose) polymer onto different acceptor proteins and itself using NAD+ as a substrate (13Schreiber V. Dantzer F. Ame J.C. de Murcia G. Nat. Rev. Mol. Cell. Biol. 2006; 7: 517-528Crossref PubMed Scopus (1551) Google Scholar). PARP-2 shares a similar catalytic domain (amino acid 202-593) as poly(ADP-ribose) polymerase-1 (PARP-1) (14Oliver A.W. Ame J.C. Roe S.M. Good V. de Murcia G. Pearl L.H. Nucleic Acids Res. 2004; 32: 456-464Crossref PubMed Scopus (91) Google Scholar), the founding member of the PARP family, though PARP-2 has a smaller reaction velocity compared with PARP-1 (12Ame J.C. Rolli V. Schreiber V. Niedergang C. Apiou F. Decker P. Muller S. Hoger T. Menissier-de Murcia J. de Murcia G. J. Biol. Chem. 1999; 274: 17860-17868Abstract Full Text Full Text PDF PubMed Scopus (601) Google Scholar).PARP-2 has multiple in vivo functions comprising DNA surveillance and DNA repair processes (reviewed in Ref. 15Huber A. Bai P. Menissier-de Murcia J. de Murcia G. DNA Repair (Amst.). 2004; 3: 1103-1108Crossref PubMed Scopus (187) Google Scholar), spermatogenesis (16Tramontano F. Di M.S. Quesada P. J. Cell. Biochem. 2005; 94: 58-66Crossref PubMed Scopus (17) Google Scholar, 17Dantzer F. Mark M. Quenet D. Scherthan H. Huber A. Liebe B. Monaco L. Chicheportiche A. Sassone-Corsi P. de Murcia G. Menissier-de Murcia J. Proc. Natl. Acad. Sci. U. S. A. 2006; 103: 14854-14859Crossref PubMed Scopus (90) Google Scholar), inflammation, and oxidative injury (18Kofler J. Otsuka T. Zhang Z. Noppens R. Grafe M.R. Koh D.W. Dawson V.L. Menisser-de Murcia J. Hurn P.D. Traystman R.J. J. Cereb. Blood Flow Metab. 2006; 26: 135-141Crossref PubMed Scopus (54) Google Scholar, 19Mota R.A. Sanchez-Bueno F. Saenz L. Hernandez-Espinosa D. Jimeno J. Tornel P.L. Martinez-Torrano A. Ramirez P. Parrilla P. Yelamos J. Lab. Invest. 2005; 85: 1250-1262Crossref PubMed Scopus (61) Google Scholar, 20Popoff I. Jijon H. Monia B. Tavernini M. Ma M. McKay R. Madsen K. J. Pharmacol. Exp. Ther. 2002; 303: 1145-1154Crossref PubMed Scopus (40) Google Scholar). Most of these functions are accomplished through protein-protein interactions. In PARP-2, the interaction platforms can be mapped to the DNA-binding domain and to the domain E (amino acids 63-202) (21Dantzer F. Giraud-Panis M.J. Jaco I. Ame J.C. Schultz I. Blasco M. Koering C.E. Gilson E. Ménissier-de Murcia J. de Murcia G. Schreiber V. Mol. Cell. Biol. 2004; 24: 1595-1607Crossref PubMed Scopus (156) Google Scholar, 22Meder V.S. Boeglin M. de Murcia G. Schreiber V. J. Cell Sci. 2005; 118: 211-222Crossref PubMed Scopus (144) Google Scholar, 23Schreiber V. Ame J.C. Dolle P. Schultz I. Rinaldi B. Fraulob V. Menissier-de Murcia J. de Murcia G. J. Biol. Chem. 2002; 277: 23028-23036Abstract Full Text Full Text PDF PubMed Scopus (570) Google Scholar, 24Saxena A. Wong L.H. Kalitsis P. Earle E. Shaffer L.G. Choo K.H. Hum. Mol. Genet. 2002; 11: 2319-2329Crossref PubMed Scopus (75) Google Scholar, 25Maeda Y. Hunter T.C. Loudy D.E. Dave V. Schreiber V. Whitsett J.A. J. Biol. Chem. 2006; 281: 9600-9606Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar). A role for PARP-2 in the regulation of transcription has already been described. In lung epithelial cells PARP-2 interacts with thyroid transcription factor-1 (TTF1). TTF1 is a homeodomain-containing transcription factor of the Nkx-2 family. In these cells, PARP-2 regulates the expression of the surfactant protein-B by affecting TTF1 activity (25Maeda Y. Hunter T.C. Loudy D.E. Dave V. Schreiber V. Whitsett J.A. J. Biol. Chem. 2006; 281: 9600-9606Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar). In this study we show that PARP-2 affects the transcriptional activity of PPARγ both in vitro and in vivo.EXPERIMENTAL PROCEDURESMaterials—All chemicals were from Sigma-Aldrich unless stated otherwise.Animals—PARP-2-/- mice and their wild-type (WT) littermates (26Menissier-de Murcia J. Ricoul M. Tartier L. Niedergang C. Huber A. Dantzer F. Schreiber V. Ame J.C. Dierich A. LeMeur M. Sabatier L. Chambon P. de Murcia G. EMBO J. 2003; 22: 2255-2263Crossref PubMed Scopus (481) Google Scholar) coming from heterozygous crossings were used. Mice were housed separately, had ad libitum access to water and chow, and were kept under a 12-h dark-light cycle. The animals were killed at the age of 7 months by cervical dislocation after 4 h of fasting, and tissues were collected.Cell Culture—3T3-L1 cells were maintained in DMEM (Invitrogen), 10% newborn calf serum (Invitrogen), Gentamicin (Invitrogen), and HEK, and mouse embryonic fibroblasts (MEFs) were maintained in DMEM, 10% fetal calf serum (Adgenix, Voisins le Bretonneux, France), and Gentamicin (Invitrogen). The 3T3-L1 cells were maintained subconfluent.MEF Preparation and Differentiation—MEFs were prepared from embryos as described elsewhere (26Menissier-de Murcia J. Ricoul M. Tartier L. Niedergang C. Huber A. Dantzer F. Schreiber V. Ame J.C. Dierich A. LeMeur M. Sabatier L. Chambon P. de Murcia G. EMBO J. 2003; 22: 2255-2263Crossref PubMed Scopus (481) Google Scholar). For the differentiation studies 4 × 105 MEFs were seeded in 12-well plates and maintained in DMEM, 10% fetal calf serum. The medium was changed every 2 days until confluence. The cells were maintained at confluency for 2 days. Cells were then differentiated in DMEM, 10% newborn calf serum, 5 μm troglitazone, 5 μm dexamethasone, 500 μm isobutylmethylxanthine, and 10 μg/ml insulin (later defined as differentiation mix), while the control cells received DMEM, 10% fetal calf serum, and Me2SO as vehicle. The medium with the differentiation mix was replaced every 2 days, and the cells were differentiated for 8 days. Control cells after confluency were cultured in DMEM plus 10% fetal calf serum containing only vehicle (Me2SO, 0.21%).DNA Constructs—To create an siRNA-expressing construct, double stranded oligonucleotides were cloned into the pSuper vector (for sequences see Table 1) (27Brummelkamp T.R. Bernards R. Agami R. Science. 2002; 296: 550-553Crossref PubMed Scopus (3942) Google Scholar). The oligonucleotides siPARP-2sense and siPARP-2antisense (containing the siRNA sequence), as well as the control scrPARP-2sense and scrPARP-2antisense (scrambled version of the siRNA sequence), respectively, were annealed in annealing buffer (150 mm NaCl, 1 mm EDTA, 50 mm Hepes, pH. 8.0). The resulting duplexes carried BglII and HindIII sites and were cloned into pSuper using these sites resulting in pSuper-siPARP-2 (oligonucleotides siPARP-2 sense plus siPARP-2 antisense) and pSuper-scrPARP-2 (oligonucleotides scrPARP-2 sense plus scrPARP-2 antisense). An EcoRV/SmaI fragment encoding mouse PARP-2 was isolated from pBC-mPARP-2 (23Schreiber V. Ame J.C. Dolle P. Schultz I. Rinaldi B. Fraulob V. Menissier-de Murcia J. de Murcia G. J. Biol. Chem. 2002; 277: 23028-23036Abstract Full Text Full Text PDF PubMed Scopus (570) Google Scholar) and inserted into the SnaBI site of pBABEpuro (Addgene, Cambridge, MA), giving the pBABE-mPARP-2 vector. All other constructs pGL3-(Jwt)3TKluc reporter construct (28Vu-Dac N. Schoonjans K. Kosykh V. Dallongeville J. Fruchart J.C. Staels B. Auwerx J. J. Clin. Invest. 1995; 96: 741-750Crossref PubMed Scopus (363) Google Scholar), pSG-PPARγ2 (3Fajas L. Auboeuf D. Raspe E. Schoonjans K. Lefebvre A.M. Saladin R. Najib J. Laville M. Fruchart J.C. Deeb S. Vidal-Puig A. Flier J. Briggs M.R. Staels B. Vidal H. Auwerx J. J. Biol. Chem. 1997; 272: 18779-18789Abstract Full Text Full Text PDF PubMed Scopus (1075) Google Scholar), pSG5-PPARα (29Issemann I. Green S. Nature. 1990; 347: 645-650Crossref PubMed Scopus (3020) Google Scholar), pSG5-PPARβ (30Amri E.Z. Bonino F. Ailhaud G. Abumrad N.A. Grimaldi P.A. J. Biol. Chem. 1995; 270: 2367-2371Abstract Full Text Full Text PDF PubMed Scopus (351) Google Scholar), pCMX-ERβ, and vitellogeninA2-ERE-TKLuc (ER-luc) (31Tremblay G.B. Tremblay A. Copeland N.G. Gilbert D.J. Jenkins N.A. Labrie F. Giguere V. Mol. Endocrinol. 1997; 11: 353-365Crossref PubMed Scopus (825) Google Scholar) were described before. The pCMV-βGal construct was used to control the transfection efficiency.TABLE 1Oligonucleotides used to generate pSuper-siPARP-2 and pSuper-scrPARP-2NameSequence (5′-3′)StructuresiPARP-2 senseGATCTAAGATGATGCCCAGAGGAACTTTCAAGAGAAGTTCCTCTGGGCATCATCTTTTTTTABglII/sense/loop/antisense/T(5)/HindIIIsiPARP-2 antisenseAGCTTAAAAAAAGATGATGCCCAGAGGAACTTCTCTTGAAAGTTCCTCTGGGCATCATCTTAHindIII/T(5)/antisense/loop/sense/BglIIscrPARP-2 senseGATCTTTCGGGGAACAAACGTGCAACTTCAAGAGAGTTGCACGTTTGTTCCCCGAATTTTTABglII/sense/loop/antisense/T(5)/HindIIIscrPARP-2 antisenseAGCTTAAAAATTCGGGGAACAAACGTGCAACTCTCTTGAAGTTGCACGTTTGTTCCCCGAAAHindIII/T(5)/antisense/loop/sense/BglII Open table in a new tab Transfections—Transfections were preformed either by the BES-buffered saline method (26Menissier-de Murcia J. Ricoul M. Tartier L. Niedergang C. Huber A. Dantzer F. Schreiber V. Ame J.C. Dierich A. LeMeur M. Sabatier L. Chambon P. de Murcia G. EMBO J. 2003; 22: 2255-2263Crossref PubMed Scopus (481) Google Scholar) or by JetPei (Polyplus Transfections, Illkirch, France).Luciferase Activity Measurement—3 × 105 HEK cells were seeded in 6-well plates and were transfected with pSuper-siPARP-2, pSuper-scrPARP-2, pBabe, or pBabe-PARP-2 using the BES-buffered saline method. Two days later the cells were once more transfected with the constructs mentioned above. Cells were transfected 24 h later with 0.6 μg of pSuper-siPARP-2/pSuper-scrPARP-2/pBabe/pBabe-PARP-2, 0.4 μg of β-galactosidase expression plasmid, 1 μg of pSG-PPARα/pSG-PPARβ/pSG-PPARγ2/pCMX-ERβ expression vector, and 1 μg of PPAR-/ER-responsive construct. Six hours after transfection, cells were scraped, and luciferase activity was determined. For the determination of PPAR activity, just before transfection, cells were washed in serum-free DMEM medium, and the transfection was carried out in DMEM plus 10% fat-free serum. As ligand we used, fenofibrate (50 μm), monoethylhexyl phthalate (100 μm), troglitazone (5 μm), and β-estradiol (10 μm). After 6 h of transfection, cells were washed with phosphate-buffered saline, scraped, and stored at -80 °C. Luciferase assay was carried out by standard procedures. Luciferase activity was expressed as luciferase activity/β-galactosidase activity.Nile Red Flow Cytometry—To assess the extent of MEF differentiation, cytosolic triglyceride content was assessed by determining Nile red uptake (modified from Ref. 32Maquoi E. Munaut C. Colige A. Collen D. Lijnen H.R. Diabetes. 2002; 51: 1093-1101Crossref PubMed Scopus (218) Google Scholar) followed by flow cytometry using a FACSCalibur machine (BD Biosciences). Cells were harvested by adding trypsin/EDTA, and the detached cells were stained with Nile red (20 μg/ml, 5 min). Cells were subjected to flow cytometric analysis with 10,000 events collected for each sample; each measurement point was repeated in 4 parallel replicates. Samples for each cell line were normalized against the non-differentiated cells of the same line. The rate of differentiation was expressed as the percentage of the differentiated cells versus total number of cells.SDS-PAGE and Western Blotting—Cells were lysed in lysis buffer (50 mm Tris, 500 mm NaCl, 1 mm EDTA, 1% Nonidet P-40, 1 mm phenylmethylsulfonyl fluoride, protease inhibitor mixture, pH 8.0). Proteins were separated by SDS-PAGE and transferred onto nitrocellulose membranes. For the detection of PARP-2, a polyclonal rabbit antibody was used 1:2,000, Alexis, Lausen, Switzerland), and actin was as detected using a rabbit polyclonal antibody (Sigma, 1:200). The secondary antibody was IgG-peroxidase conjugate (Sigma, 1:10,000). Reactions were developed by enhanced chemiluminescence (Amersham Biosciences, Little Chalfont, UK).Total RNA Preparation, Reverse Transcription, and qPCR—Total RNA was prepared using TRIzol (Invitrogen) according to the manufacturer's instructions. RNA was treated with DNase, and 2 μg of RNA was used for reverse transcription (RT). cDNA was purified on QIAquick PCR cleanup columns (Qiagen, Valencia, CA). 50× diluted cDNA was used for quantitative PCR (qPCR) reactions. The qPCR reactions were preformed using the Light-Cycler system (Roche Applied Science) and a qPCR Supermix (Qiagen) with the primers summarized in Table 2.TABLE 2qPCR primersNameSequence (5′-3′)Accession numberAdiponectinF 5′-AAG AAG GAC AAG GCC GTT CTC TT-3′ (652-674)NM_009605.4R 5′-GCT ATG GGT AGT TGC AGT CAG TT-3′ (875-853)aP2F 5′-TGC CAC AAG GAA AGT GGC AG-3′ (132-151)BC054426R 5′-CTT CAC CTT CCT GTC GTC TG-3′ (294-275)CD36F 5′-GAT GTG GAA CCC ATA ACT GGA TTC AC-3′ (1378-1403)NM_007643R 5′-GGT CCC AGT CTC AAT TAG CCA CAG TA-3′ (1527-1502)Cyclophylin BF 5′-TGG AGA GCA CCA AGA CAG ACA-3′ (561-581)M60456R 5′-TGC CGG AGT CGA CAA TGA T-3′ (626-608)FASF 5′-GCT GCG GAA ACT TCA GGA AAT-3′ (6612-6632)BC046513R 5′-AGA GAC GTG TCA CTC CTG GAC TT-3′ (6695-6673)LPLF 5′-AGG ACC CCT GAA GAC AC-3′ (317-333)BC003305R 5′-GGC ACC CAA CTC TCA TA-3′ (465-449)LeptinF 5′-GAC ACC AAA ACC CTC AT-3′ (147-163)NM_008493R 5′-CAG AGT CTG GTC CAT CT-3′ (296-280)PerilipinF 5′-GCT TCT TCC GGC CCA GC-3′ (1511-1527)NM_175640R 5′-CTC TTC TTG CGC AGC TGG CT-3′ (1580-1561)PPARγ1F 5′-CCA CCA ACT TCG GAA TCA GCT-3′ (158-178)NM_011146R 3′-TTT GTG GAT CCG GCA GTT AAG A-3′ (591-570)PPARγ2F 5′-ATG GGTG AAA CTC TGG GAG ATT CT-3′ (46-69)AY243585R 5′-CTT GGA GCT TCA GGT CAT ATT TGT A-3′ (346-322)HSLF 5′-CCT CAT GGC TCA ACT CC-3′ (1633/2075-1649/2091)NM_001039507.1/NM_010719.5R 5′-GGT TCT TGA CTA TGG GTG A-3′ (2067/2509-2049/2491)TNFαF 5′-GCC ACC ACG CTC TTC TG-3′ (286-302)NM_013693.2R 3′-GGT GTG GGT GAG GAG CA-3′ (627-611) Open table in a new tab Chromatin Immunoprecipitation—Chromatin immunoprecipitation was performed according to a previous study (33Balint B.L. Szanto A. Madi A. Bauer U.M. Gabor P. Benko S. Puskas L.G. Davies P.J. Nagy L. Mol. Cell. Biol. 2005; 25: 5648-5663Crossref PubMed Scopus (50) Google Scholar) on 3T3-L1 cells using α-PARP-2, α-PPARγ2 (Alexis), and α-matrix metalloproteinase-9 (Santa Cruz Biotechnology, Santa Cruz, CA) antibodies. We used also a no antibody control. The chromatin fragments collected upon precipitation with the above antibodies were amplified using promoter-specific primers by qPCR. For the analysis of the coding sequence the same qPCR primer set was used as the one for the quantitation of the given gene. The respective primers are listed in Tables 2 and 3. The results were normalized for the signal of the input and were expressed as a percentage of the aP2 signal with the PARP-2 antibody.TABLE 3Chip primersNameSequenceReferenceaP2F 5′-CCC AGC AGG AAT CAG GTA GC-3′52R 5′-AGA GGG CGG AGC AGT TCA TC-3′CD36F 5′-TTT GCT GGG ACA GAC CAA TC-3′39R 5′-GCC ATG TTC CCA TCC AAG TA-3′K19F 5′-AAG GGT GGA GGT GTC TTG GT-3′AF237661R 5′-GCT TCT TTA CAC TCC TGC T AAA-3′ Open table in a new tab For the testing of the K19 primer set we used non-confluent 3T3-L1 cells transfected with pCMX-ERβ. Chromatin immunoprecipitation was performed using the α-ERβ (Santa Cruz Biotechnology), and as controls we used an α-MRE11 (Santa Cruz Biotechnology) and a no antibody control. The chromatin fragments collected upon precipitation with the above antibodies were amplified using K19 promoter-specific primers by qPCR.Microscopy—Formaldehyde-fixed, paraffin-embedded sections (7 μm) were made from WAT samples and were stained with hematoxylin and eosine. The same sections were stained with a biotin-conjugated F4/80 antibody (Serotec, Raleigh, NC, 1:100 dilution), and the bound primary antibodies were detected using streptavidin-peroxidase (Vector ABC kit) and diaminobenzidine as chromogenic substrate. Terminally differentiated MEFs were stained by Oil red O as described elsewhere.Triglyceride Measurement—The triglyceride content of the MEFs was determined using a commercially available Sigma kit according to the manufacturer's instructions.Statistical Analysis—Significance was analyzed by Student's t test. Error bars represent ± S.E., unless noted otherwise.RESULTSIn Vivo Dysfunction of the PPARγ/RXR Heterodimer in the WAT of PARP-2-/- Mice—The different fat depots (epididymal, mesenteric, and inguinal) and the interscapular brown adipose tissue-associated WAT were measured in 7-month-old PARP-2-/- mice and their wild-type littermates. A proportional loss of the weight of all adipose tissue depots was observed in the PARP-2-/- mice (Fig. 1A).Histological examination of the PARP-2-/- epididymal WAT showed adipocytes with reduced and irregular size. This tissue contained diluted capillaries, indicative of inflammation, which was confirmed by a faint staining with the macrophage-specific F4/80 antibody in the PARP-2-/- (Fig. 1, B and C) and the macroscopic appearance of the WAT (Fig. 1A). The F4/80-positive cells were present in the vicinity of the blood vessels.To identify the molecular changes that contribute to the decreased fat accumulation and abnormal adipocyte morphology, we determined the expression of the PPARγ target genes, TNFα, and hormone-sensitive lipase by RT-qPCR in the epididymal WAT.TNFα expression was undetectable in 8 of the 22 mice used for this study (4 out of 14 PARP-2+/+ and 4 out of 8 PARP-2-/-). In the TNFα-positive mice, expression levels were not different, ruling out a major role for inflammation in the adipose tissue dysfunction in PARP-2-/- mice. The expression level of hormone-sensitive lipase, which is responsible for lipolysis, was also not different between the two genotypes. The expression of several PPARγ target genes, however, was markedly decreased. These include genes involved in chylomicron and very low density lipoprotein triglyceride hydrolysis (lipoprotein lipase), free fatty acid uptake (CD36), de novo fatty acid synthesis, and endocrine signaling (leptin and adiponectin) (Fig. 1D). Interestingly, no difference was detected in PPARγ1 and PPARγ2 mRNA levels between the different genotypes.MEF Differentiation Is Affected by PARP-2 Ablation—We next aimed to determine whether MEFs differentiation toward adipocytes was affected by the PARP-2 deletion. Differentiation of PAPR-2-/- MEFs into adipocytes was decreased as judged by Oil red O staining, determination of lipid content, and Nile red staining followed by fluorescence-activated cell sorting analysis (Fig. 2A).FIGURE 2Effect of PARP-2 on MEF differentiation into adipocytes. A, MEFs were differentiated into adipocytes and stained with Oil red O. On the terminally differentiated MEFs, Nile red fluorescence-activated cell sorting analysis and lipid measurements were performed. The left histogram shows the percentage of differentiation as measured with Nile red, and the right histogram shows the accumulation of lipids in the culture. *, p < 0.05; **, p < 0.01. B, expression of selected marker genes of adipocyte differentiation as measured by RT-qPCR on MEF cDNA samples (*, p < 0.05; **, p < 0.01).View Large Image Figure ViewerDownload Hi-res image Download (PPT)The expression of genes involved in adipocyte differentiation and function such as PPARγ1 and PPARγ2 were decreased in the PARP-2-/- MEFs (34Saladin R. Fajas L. Dana S. Halvorsen Y.D. Auwerx J. Briggs M. Cell Growth & Differ. 1999; 10: 43-48PubMed Google Scholar). Because the PPARγ transcripts are primarily present in the differentiated cells, these data confirm that PARP-2-/- cells differentiate less into adipocytes. The expression of PPARγ target genes, such as lipoprotein lipase, fatty acid synthase, leptin, adiponectin, and adipocyte fatty acid-binding protein 2 (aP2), were decreased in parallel (Fig. 2B).PARP-2 Expression Modulates Transactivation of PPARs—To measure whether changes in PARP-2 expression affect PPAR transactivation, we used HEK 293 cells transfected with a PPARγ2 expression vector and a PPARγ-responsive luciferase construct. In these experiments we modulated the expression of PARP-2 expression by overexpression and siRNA depletion. For the siRNA depletion of PARP-2 we used the pSuper-siPARP-2 construct, whereas for PARP-2 overexpression we used the pBabe-PARP-2. The pSuper-scrPARP-2 and the empty pBabe vector served as the respective controls. PARP-2 levels were assessed by Western blotting using a PARP-2-specific antibody. For both constructs, the cells were transfected twice, on day 0 and on day 2. On day 3, the specific siRNA decreased PARP-2 protein levels significantly, whereas the scrambled PARP-2 siRNA did not alter the PARP-2 levels. A strong increase in PARP-2 protein was observed on day 3 of the overexpression experiment (Fig. 3).FIGURE 3Characterization of the pSuper-scrPARP-2 and the pSuper-siPARP-2 constructs. 3 × 107 HEK cells were plated in Petri dishes and were BES-buffered saline transfected on day 0 and on day 2. Cells were scraped from day 2 daily. These samples were analyzed by Western blotting. PARP-2 was depleted by the pSuper-siPARP-2 construct, but was unmodified by the pSuper-scrPARP-2 construct. Whereas the transfection with pBabe-PARP-2 resulted on day 3 and day 4 in a robust induction of PARP-2 expression, the transfection with pBabe alone did not modify PARP-2 expression.View Large Image Figure ViewerDownload Hi-res