Peculiar features of the plastids of the colourless alga Euglena longa and photosynthetic euglenophytes unveiled by transcriptome analyses

Kristína Záhonová,Marek Eliáš,Zoltán Füssy,Miroslav Oborník,Matej Vesteg,Anna M G Novák Vanclová,Erik Birčák,Vladimír Klimeš,Juraj Krajčovič

doi:10.1038/s41598-018-35389-1

Abstract

Euglenophytes are a familiar algal group with green alga-derived secondary plastids, but the knowledge of euglenophyte plastid function and evolution is still highly incomplete. With this in mind we sequenced and analysed the transcriptome of the non-photosynthetic species Euglena longa. The transcriptomic data confirmed the absence of genes for the photosynthetic machinery, but provided candidate plastid-localised proteins bearing N-terminal bipartite topogenic signals (BTSs) of the characteristic euglenophyte type. Further comparative analyses including transcriptome assemblies available for photosynthetic euglenophytes enabled us to unveil salient aspects of the basic euglenophyte plastid infrastructure, such as plastidial targeting of several proteins as C-terminal translational fusions with other BTS-bearing proteins or replacement of the conventional eubacteria-derived plastidial ribosomal protein L24 by homologs of archaeo-eukaryotic origin. Strikingly, no homologs of any key component of the TOC/TIC system and the plastid division apparatus are discernible in euglenophytes, and the machinery for intraplastidial protein targeting has been simplified by the loss of the cpSRP/cpFtsY system and the SEC2 translocon. Lastly, euglenophytes proved to encode a plastid-targeted homolog of the termination factor Rho horizontally acquired from a Lambdaproteobacteria-related donor. Our study thus further documents a substantial remodelling of the euglenophyte plastid compared to its green algal progenitor.

Highlights

Euglenophytes, exemplified by the highly studied mixotrophic alga Euglena gracilis, are a group of flagellated algae constituting one of the many lineages of the phylum Euglenozoa[1]
Our transcriptomic assembly of E. longa resulted in 65,563 transcript models, a number somewhat smaller than the numbers reported in recent transcriptomic studies for E. gracilis (113,152, ref.10; 72,506, refs4,8)
Since the use of different sequence assembly algorithms certainly contributes to the difference in contig numbers, we carried out a BUSCO search for conserved unique eukaryote orthologs to assess the quality of our data. 89.1% of BUSCO genes were found to be complete in our dataset, and further 4.3% of orthologs to be present as fragments

Summary

Introduction

Euglenophytes, exemplified by the highly studied mixotrophic alga Euglena gracilis, are a group of flagellated algae constituting one of the many lineages of the phylum Euglenozoa[1]. Euglenozoans employ trans-splicing to process mRNA molecules, whereby the 5′-end of pre-mRNA is replaced by the 5′-end of the specialised spliced leader (SL) RNA, resulting in the presence of an invariant SL sequence (ACTTTCTGAGTGTCTATTTTTTTTCG in E. gracilis) at the 5′-end of mature mRNAs6,7 Despite their interesting biology, euglenophytes have not yet been properly studied by genome-wide approaches. The E. gracilis plastid-targeted proteins bear a discernible presequence, an N-terminal bipartite topogenic signal (BTS), which comes in two main variants[16] Both include an N-terminal signal peptide mediating the import into the ER, followed by a plastid transit peptide that is exposed upon signal peptide cleavage and mediates the import across the two inner chloroplast membranes. The physiological role of the E. longa plastid remains unknown

Methods

Results

Conclusion