PCR-based rapid genotyping of Stenotrophomonas maltophiliaisolates

Emanuela Roscetto,Bianca Colonna,Francesco Rocco,Pier Paolo Di Nocera,Raffaele Zarrilli,M Stella Carlomagno,Mariassunta Casalino

doi:10.1186/1471-2180-8-202

Abstract

BackgroundAll bacterial genomes contain repetitive sequences which are members of specific DNA families. Such repeats may occur as single units, or found clustered in multiple copies in a head-to-tail configuration at specific loci. The number of clustered units per locus is a strain-defining parameter. Assessing the length variability of clusters of repeats is a versatile typing methodology known as multilocus variable number of tandem repeat analysis (MLVA).ResultsStenotrophomonas maltophilia is an environmental bacterium increasingly involved in nosocomial infections and resistant to most antibiotics. The availability of the whole DNA sequence of the S. maltophilia strain K279a allowed us to set up fast and accurate PCR-based diagnostic protocols based on the measurement of length variations of loci carrying a variable number of short palindromic repeats marking the S. maltophilia genome. On the basis of the amplimers size, it was possible to deduce the number of repeats present at 12 different loci in a collection of S. maltophilia isolates, and therefore label each of them with a digit. PCR-negative regions were labelled 0. Co-amplification of two pairs of loci provided a 4-digit code sufficient for immediate subtyping. By increasing the number of loci analyzed, it should be possible to assign a more specific digit profile to isolates. In general, MLVA data match genotyping data obtained by PFGE (pulsed-field gel electrophoresis). However, some isolates exhibiting the same PCR profiles at all loci display distinct PFGE patterns.ConclusionThe utilization of the present protocol allows to type several S. maltophilia isolates in hours. The results are immediately interpretable without the need for sophisticated softwares. The data can be easily reproducible, and compared among different laboratories.

Highlights

All bacterial genomes contain repetitive sequences which are members of specific DNA families
The utilization of the present protocol allows to type several S. maltophilia isolates in hours
We found that the K279a chromosome hosts an abundant family of small, palindromic repeats fitting the consensus GTAGTGCCGGCCGCTGGCCGGCA that we called SMAG because they carry the tetranucleotide GTAG at one terminus, to small repetitive extragenic palindromic sequences (REPs) identified in the genomes of Escherichia coli and other microrganisms [21]

Summary

Introduction

All bacterial genomes contain repetitive sequences which are members of specific DNA families Such repeats may occur as single units, or found clustered in multiple copies in a head-to-tail configuration at specific loci. After years of debate regarding its appropriate taxonomic position, the nonfermentative, gram-negative bacillus previously known as Pseudomonas maltophilia or Xanthomonas maltophilia, has been definitively classified as Stenotrophomonas maltophilia [1]. This species is found in a wide variety of environments, and has been isolated from different sources, including water, sewage, soil and plant rhizosphere environments [2]. In mixed infection formed in the CF lungs, S. maltophilia has been shown to influence the architecture of Pseudomonas aeruginosa biofilms by producing a diffusable signal factor [4]

Methods

Results

Discussion

Conclusion