Abstract
We recently developed activatable cell-penetrating peptides (ACPPs) that target contrast agents to in vivo sites of matrix metalloproteinase activity, such as tumors. Here we use parallel in vivo and in vitro selection with phage display to identify novel tumor-homing ACPPs with no bias for primary sequence or target protease. Specifically, phage displaying a library of ACPPs were either injected into tumor-bearing mice, followed by isolation of cleaved phage from dissected tumor, or isolated based on selective cleavage by extracts of tumor versus normal tissue. Selected sequences were synthesized as fluorescently labeled peptides, and tumor-specific cleavage was confirmed by digestion with tissue extracts. The most efficiently cleaved peptide contained the substrate sequence RLQLKL and labeled tumors and metastases from several cancer models with up to 5-fold contrast. This uniquely identified ACPP was not cleaved by matrix metalloproteinases or various coagulation factors but was efficiently cleaved by plasmin and elastases, both of which have been shown to be aberrantly overexpressed in tumors. The identification of an ACPP that targets tumor expressed proteases without rational design highlights the value of unbiased selection schemes for the development of potential therapeutic agents.
Highlights
22532 JOURNAL OF BIOLOGICAL CHEMISTRY lation of peptide-conjugated cargo within tissues containing active extracellular proteases (1– 6)
In vivo properties could be further modulated by attachment to other high molecular weight carriers for improved pharmacokinetics or increased valency of the activatable cell-penetrating peptides (ACPPs) to enhance tissue specific uptake
Because this method identifies a specific ACPP cleavage sequence, traditional biochemical techniques, including inhibitor and enzyme assays, extraction methods, or activitybased protease profiling (42), can be used to identify the target protease(s). We have used these techniques to characterize the cleavage of RLQLKL ACPP and demonstrate cleavage by multiple serine proteases
Summary
Phage Library Preparation and Selection—A phage library was generated by PCR, using 5Ј-primer ggccaagagctccatcatcatcatcatcatctc, 3Ј-primer ggccagactagtccgtcgccgtcgccgtcg, and oligonucleotide template ccatcatcatcatcatcatctcgaggaggaggaggaggaggaggaggagnnknnknnknnknnknnkcggcgacggcgacggcgacggcgacggactag, where n denotes any nucleotide and k indicates a mixture of g and t. Uncleaved phage were removed by absorption with Ni2ϩ-NTA-agarose, and cleaved phage from the supernatant were reamplified and reinjected into different PyMT tumor-bearing mice. In vitro cleavages were done with 5 M peptide in 20 l of PBS containing 1 M ZnCl2 plus 2 l of 20% tissue extract (20 mg of tissue homogenate per 100 l) or 2 l of undiluted cystic fluid, followed by incubation at 37 °C. Each peptide was purified from homogenized cell extract by two steps of reverse phase HPLC. Uncleaved phage selected for resistance to liver/kidney cleavage and less likely to be efficiently cleaved in that tissue were purified by presence of their hexahistidine tag and exposed to tumor tissue extract for 3 h. Phage (109 in 100 l of PBS) were injected into PyMT tumor-bearing mice. We used either PyMT mice with nine selected regions of 80 –200 pixels of each type of tissue, spontaneous progressive mammary tumors or nude mice and all tissues were imaged using identical parameters
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
