Abstract
Autophagy is a bulk degradation pathway, and selective autophagy to remove foreign entities is called xenophagy. The conjugation of ubiquitin to target pathogens is an important process in xenophagy but when and where this ubiquitination occurs remains unclear. Here, we analyzed the temporal sequence and subcellular location of ubiquitination during xenophagy using time‐lapse observations, with polystyrene beads mimicking invading pathogens. Results revealed accumulation of a ubiquitination marker around the beads within 3 min after endosome rupture. Recruitment of ubiquitin to the beads was significantly delayed in p62‐knockout murine embryonic fibroblast cells, and this delay was rescued by ectopic p62 expression. Ectopic expression of a phosphorylation‐mimicking p62 mutated at serine residue 405 (equivalent to human serine residue 403) rescued this delay, but its unphosphorylated form did not. These results indicate that ubiquitination mainly occurs after endosome rupture and suggest that p62, specifically the phosphorylated form, promotes ubiquitin conjugation to target proteins in xenophagy.
Highlights
Autophagy is a bulk degradation pathway, and selective autophagy to remove foreign entities is called xenophagy
We observed ubiquitin dynamics in p62-depleted cells using the same system. These results show that ubiquitination mainly occurs in ruptured endosomal membranes after endosome rupture and that the ubiquitination process is promoted by the autophagy receptor protein p62
Ubiquitin assembles around the invading beads following endosome rupture To investigate when and where ubiquitination occurs during xenophagy, we developed the following experimental system using polystyrene beads
Summary
To construct the PBEF1-EGFP-MCS-neo vector, the DNA fragment encoding GFP was amplified from the pEGFPC1 vector (PT3028-5; Clontech Laboratories, Mountain View, CA, USA) using PCR and the primers 50-TGT GACCGGGCGCCTACTATGGTGAGCAAGGGCGAGG AGCT-30 and 50-CGAATTCGCTAGCTCTAGACTTGTA CAGCTCGTCCATGC-30 and inserted into the PBEF1MCS-IRES-neo cDNA expression vector (PB533A-2; System Biosciences, Palo Alto, CA, USA) after digestion with XbaI. To construct the PBEF1-EGFP-Ubwt-neo vector (GFP-Ubwt-neo), the DNA fragment encoding human wild-type (WT) ubiquitin (Ubwt) was amplified from the cDNA of HeLa cells using PCR and the primers 50-TCTA GAGCTAGCGAATTCATGCAGATCTTCGTGAAGACT CTGA-30 and 50-TCCGATTTAAATTCGAATTCTTACC CACCTCTGAGACGGAGTAC-30 and inserted into the PBEF1-EGFP-MCS-neo vector after digestion with EcoRI. To construct the PBEF1-EGFP-Ubunconj-neo vector (GFP-Ubunconj-neo), the DNA fragment encoding a ubiquitin mutant (Ubunconj) was amplified from pGEX6P-1hUbiquitin K0 (kindly provided by Yasushi Saeki, Tokyo Metropolitan Institute of Medical Science, Tokyo, Japan) using PCR and the primers 50-CTAGAGCTAGCGAATT CATGCAGATTTTCGTGAGAACCC-30 and 50-TCCGAT TTAAATTCGAATTCTTAAACACCACGAAGTCTCA-30 and inserted into the PBEF1-EGFP-MCS-neo vector after digestion with EcoRI. To construct the expression plasmids for the p62S405A mutant involving substitution of the serine at residue 405 with alanine, PCR was performed using primers 50-CTCTCCCAGATGCTG GCCATGGGTTTCTCGGATGAA-30 and 50-TTCATCCG AGAAACCCATGGCCAGCATCTGGGAGAG-30.
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
