P53-dependent Down-regulation of Telomerase Is Mediated by p21waf1

Igor Shats,Michael Milyavsky,Xiaohu Tang,Perry Stambolsky,Neta Erez,Ran Brosh,Ira Kogan,Ilana Braunstein,Maty Tzukerman,Doron Ginsberg,Varda Rotter

doi:10.1074/jbc.m402502200

Abstract

Inactivation of p53 and activation of telomerase occur in the majority of human cancers, raising the possibility of a link between these two pathways. Overexpression of wild-type p53 down-regulates the enzymatic activity of telomerase in various cancer cell lines through transcriptional repression of its catalytic subunit, human telomerase reverse transcriptase (hTERT). In this study, we re-evaluated the role of p53 in telomerase regulation using isogenic cell lines expressing physiological levels of p53. We demonstrate that endogenous wild-type p53 was able to down-regulate telomerase activity, hTERT mRNA levels, and promoter activity; however, the ability to repress hTERT expression was found to be cell type-specific. The integrity of the DNA-binding core domain, the N-terminal transactivation domain, and the C-terminal oligomerization domains of p53 was essential for hTERT promoter repression, whereas the proline-rich domain and the extreme C terminus were not required. Southwestern and chromatin immunoprecipitation experiments demonstrated lack of p53 binding to the hTERT promoter, raising the possibility of an indirect repressive mechanism. The down-regulation of hTERT promoter activity was abolished by a dominant-negative E2F1 mutant. Mutational analysis identified a specific E2F site responsible for p53-mediated repression. Knockdown of the key p53 transcriptional target, p21, was sufficient to eliminate the p53-dependent repression of hTERT. Inactivation of the Rb family using either viral oncoproteins or RNA interference attenuated the repression. Inhibition of histone deacetylases also interfered with the repression of hTERT by p53. Therefore, our results suggest that repression of hTERT by endogenous p53 is mediated by p21 and E2F.

Highlights

Inactivation of p53 and activation of telomerase occur in the majority of human cancers, raising the possibility of a link between these two pathways
We demonstrate that endogenous wild-type p53 was able to down-regulate telomerase activity, human telomerase reverse transcriptase (hTERT) mRNA levels, and promoter activity; the ability to repress hTERT expression was found to be cell type-specific
Parental cells containing endogenous wild type-p53 and their derivatives with inactivated p53 were treated with 0.4 ␮M doxorubicin for 24 or 48 h, and hTERT mRNA levels were determined by real-time quantitative Reverse Transcription (RT)-PCR

Summary

EXPERIMENTAL PROCEDURES

Cell Lines—Human non-small cell lung cancer cell line H1299 and prostate cancer cell line LNCaP were maintained in RPMI 1640 medium supplemented with 10% fetal calf serum and antibiotics. The human breast cancer cell line MCF7 stably expressing small interfering RNA (siRNA) targeting p53 and its vector control line were a gift from Dr R. Plasmids—The reporter construct containing the p21 promoter (pGL3-Waf1), the expression vectors for a dominant-negative p53 peptide (p53-DD) [18], a p53 deletion mutant lacking the proline-rich domain (62–91del), and wild-type E7 and its deletion mutant lacking the pocket protein-binding region (E7del21–35) were a gift from Dr M. The primers used for the detection of hTERT promoter sequences that amplify region Ϫ217 to ϩ119 relative to the transcription initiation site were 5ЈCAGGCCGGGCTCCCAGTGGA and 3Ј-CAGCAGGGAGCGCACGGCTC. Cells were transfected by FuGENE 6 transfection reagent (Roche Applied Science) using 300 ng of promoter-luciferase reporter constructs, the indicated amounts of expression plasmids, and 100 ng of pCMV-␤-galactosidase expression vector for normalization of transfection efficiency. Telomerase enzymatic activity was measured using the real-time telomeric repeat amplification protocol essentially as described [28]

RESULTS

Colon cancer

Findings

DISCUSSION