Abstract
BackgroundCarbapenemase-producing Enterobacteriaceae (CRE) are a global problem and prevalence of CR genes differs across geographical regions. The current Sri Lankan situation is unknown; hence, this study aimed to identify three commonly occurring CR genes in the region.MethodsEnterobacteriaceae isolates resistant to carbapenems were collected from clinical samples submitted for routine testing to the microbiology laboratory of National Cancer Institute. Species identification was done using conventional biochemicals and CLSI disc diffusion method was used for ABST of CRE isolates. Identification of CR genes was done by in-house conventional multiplex PCR, using previously described primers (Table 1). Ten microlitres of total DNA from each sample, extracted by heat shock method, was subjected to multiplex PCR in a 50 μL of PCR mixture which contained 5× PCR buffer (10 mmol/L Tris–HCl, 50 mmol/L KCl), 2.5 mmol/L of MgCl2, 10 mmol/L of deoxynucleotide triphosphate, 5 U/mL of Taq Polymerase and 20 μmol/L of each primer. The PCR program was run at 94°C for 3 min, followed by 30 cycles of 95°C for 1 min, 55°C for 30 s and 73°C for 1 min, with a final extension at 72°C for 5 min. Products were visualized by electrophoresis in 2% agarose gel (Figure 1).Table 1.Oligonucleotides used in the studyPrimerPrimer (5′–3′)GeneProduct sizeKPC-FCGTCTAGTTCTGCTGTCTTG bla KPC798 bpKPC-RCTTGTCATCCTTGTTAGGCGNDM-FGGTTTGGCGATCTGGTTTTC bla NDM621 bpNDM-RCGGAATGGCTCATCACGATCOXA48-FGCGTGGTTAAGGATGAACAC bla OXA-48438 bpOXA48-RCATCAAGTTCAACCCAACCGFigure 1.Agarose gel electrophoresis (2%). Samples in lanes 1, 2, 5 and 6 are positive for blaOXA-48; samples in lanes 3, 4, 8 and 9 are positive for blaNDM and sample in lane 10 is positive for blaKPC. Sample in lane 7 is positive for both blaNDM and blaOXA-48.ResultsA total of 123 isolates were tested. Klebsiella pneumoniae was the predominant carbapenemase producer (58.5%). Sixty-six (53.6%) isolates harboured blaOXA-48 and 47 (38.2%) had blaNDM. Only one isolate was positive for blaKPC. Thirteen (10.5%) had both blaOXA-48 and blaNDM and 9 (7%) tested negative for all three genes.Conclusions bla OXA-48 and blaNDM being common and blaKPC being very rare is expected with the geographical location of the country. Noted high prevalence and co-occurrence of CR genes among CRE isolates is alarming and pose a threat to patient management and infection control of the institution.
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.