Abstract
MC2 (ACTH) receptors require MC2 receptor accessory protein (MRAP) to reach the cell surface. In this study, we show that MRAP has the opposite effect on the closely related MC5 receptor. In enzyme-linked immunosorbent assay and microscopy experiments, MC2 receptor was retained in the endoplasmic reticulum in the absence of MRAP and targeted to the plasma membrane with MRAP. MC5 receptor was at the plasma membrane in the absence of MRAP, but trapped intracellularly when expressed with MRAP. Using bimolecular fluorescence complementation, where one fragment of yellow fluorescent protein (YFP) was fused to receptors and another to MRAP, we showed that MC2 receptor-MRAP dimers were present at the plasma membrane, whereas MC5 receptor-MRAP dimers were intracellular. Both MC2 and MC5 receptors co-precipitated with MRAP. MRAP did not alter expression of beta2-adrenergic receptors or co-precipitate with them. To determine if MRAP affects formation of receptor oligomers, we co-expressed MC2 receptors fused to YFP fragments in the presence or absence of MRAP. YFP fluorescence, reporting MC2 receptor homodimers, was readily detectable with or without MRAP. In contrast, MC5 receptor homodimers were visible in the absence of MRAP, but little fluorescence was observed by microscopic analysis when MRAP was co-expressed. Co-precipitation of differentially tagged receptors confirmed that MRAP blocks MC5 receptor dimerization. The regions of MRAP required for its effects on MC2 and MC5 receptors differed. These results establish that MRAP forms stable complexes with two different melanocortin receptors, facilitating surface expression of MC2 receptor but disrupting dimerization and surface localization of MC5 receptor.
Highlights
Effect of MC2 receptor accessory protein (MRAP) on MC5 Receptor Expression—Unlike the MC2 receptor, MC5 receptor traffics readily to the plasma membrane when expressed in CHO cells in the absence of MRAP [3, 6, 14]
Because MC2 and MC5 receptors are expressed together in several systems, including adipocytes [11], we investigated the effect of MRAP on the MC5 receptor using receptors epitope-tagged at the extracellular N terminus
To verify that the bands described earlier were representative of glycosylated forms of the MC5 receptor, we expressed MC5 receptor with or without MRAP, immunoprecipitated the receptor, and treated the samples with peptide N-glycosidase
Summary
Materials— hMC2, MC5, and 2-adrenergic receptors with three amino-terminal HA tags and RAMP3 were obtained from Missouri S&T cDNA Resource Center and YFP-F1 and YFP-F2 constructs from Dr Catherine Berlot (Weis Center for Research, Geisinger Clinic, Danville, PA) [13]. Construction of Split-YFP Vectors—To make 3HA-MC5RYFP-F1 and 3HA-MC5R-YFP-F2, 3HA-MC5R with exclusion of the stop codon was amplified from the 3HA-MC5R in pcDNA3.1ϩ plasmid using the following primers: forward, TATATATATAGCTAGCGTTTAAACTTAAGCTTGGTACC and reverse, TATATATATAACGCGTATCCCTTCTGGGAAAGCTGCAGGCG. YFP-F2 was inserted after the MRAP coding region, producing V5-MRAP-YFP-F2 in pciNeo. RT-PCR—mRNA extraction from mouse adrenal glands and Y1 cells was performed using the RNeasy kit and RT-PCR using the SuperScript III One-Step RT-PCR system from Invitrogen following the manufacturer’s instructions and appropriate primers (primer sequences available on request). Live Cell Imaging—Cells on glass coverslips were rinsed and incubated with anti-V5 antibody at 1:100 in Dulbecco’s modified Eagle’s medium/F-12 media supplemented with 5% fetal bovine serum for 1 h at 37 °C, washed, and incubated with 1:100 anti-mouse antibody coupled to Alexa546 for 5 min at room temperature. Blots were probed with IRDye 800CW goat anti-mouse IgG from LiCor, scanned on a LiCor Imaging System and analyzed using Odyssey software
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
