Abstract

BackgroundSplicing is more efficient when coupled with transcription and it has been proposed that nucleosomes enriched in exons are important for splice site recognition. Lynch syndrome is a familial cancer syndrome that can be caused by the autosomal dominant inheritance of splice site mutations in the MutL homolog 1 (MLH1) gene. To better understand the role of nucleosomes in splicing, we used MLH1 splice site mutations in Lynch syndrome cases as a model to investigate if abnormal splicing was associated with altered nucleosome positioning at exon-intron boundaries.FindingsNucleosome Occupancy and Methylome sequencing (NOMe-seq) was used to determine the allele-specific positioning of nucleosomes around heterozygous splice site mutations in lymphoblastoid cells lines (LCLs) derived from six Lynch syndrome patients. These mutations were previously shown to cause exon skipping in five of the six patients. Allele-specific high-resolution nucleosome mapping across exons and exon-intron boundaries revealed high levels of nucleosomes across all regions examined. Alleles containing donor or acceptor splice site mutations showed no consistent alteration in nucleosome positioning or occupancy.ConclusionNucleosomes were enriched at MLH1 exons in LCLs derived from Lynch syndrome patients, and in this model system the positioning of nucleosomes was unaltered at exon-intron boundaries containing splice site mutations. Thus, these splice site mutations alone do not significantly change the local organisation of nucleosomes.

Highlights

  • Splicing is more efficient when coupled with transcription and it has been proposed that nucleosomes enriched in exons are important for splice site recognition

  • Nucleosomes were enriched at MutL homolog 1 (MLH1) exons in lymphoblastoid cells lines (LCLs) derived from Lynch syndrome patients, and in this model system the positioning of nucleosomes was unaltered at exon-intron boundaries containing splice site mutations

  • We investigated cells from Lynch syndrome patients with splice site mutations to determine whether splicing aberrations were associated with altered nucleosome positioning at exon-intron boundaries

Read more

Summary

Conclusion

Nucleosomes were enriched at MLH1 exons in LCLs derived from Lynch syndrome patients, and in this model system the positioning of nucleosomes was unaltered at exon-intron boundaries containing splice site mutations.

Background
Materials and methods
F: GAGAAGAAAAAGTTTAGATTTTATA
Discussion
Black DL

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call

Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.