Normal versus Pathological Cardiac Fibroblast-Derived Extracellular Matrix Differentially Modulates Cardiosphere-Derived Cell Paracrine Properties and Commitment

Francesca Pagano,Clotilde Castaldo,Ciro Maiello,Franca Di Meglio,Francesco Angelini,Giacomo Frati,Isotta Chimenti,Daria Nurzynska,Sebastiano Sciarretta,Elisa Messina,Vittorio Picchio,Giuseppe Biondi-Zoccai

doi:10.1155/2017/7396462

Abstract

Human resident cardiac progenitor cells (CPCs) isolated as cardiosphere-derived cells (CDCs) are under clinical evaluation as a therapeutic product for cardiac regenerative medicine. Unfortunately, limited engraftment and differentiation potential of transplanted cells significantly hamper therapeutic success. Moreover, maladaptive remodelling of the extracellular matrix (ECM) during heart failure progression provides impaired biological and mechanical signals to cardiac cells, including CPCs. In this study, we aimed at investigating the differential effect on the phenotype of human CDCs of cardiac fibroblast-derived ECM substrates from healthy or diseased hearts, named, respectively, normal or pathological cardiogel (CG-N/P). After 7 days of culture, results show increased levels of cardiogenic gene expression (NKX2.5, CX43) on both decellularized cardiogels compared to control, while the proportion and staining patterns of GATA4, OCT4, NKX2.5, ACTA1, VIM, and CD90-positive CPCs were not affected, as assessed by immunofluorescence microscopy and flow cytometry analyses. Nonetheless, CDCs cultured on CG-N secreted significantly higher levels of osteopontin, FGF6, FGF7, NT-3, IGFBP4, and TIMP-2 compared to those cultured on CG-P, suggesting overall a reduced trophic and antiremodelling paracrine profile of CDCs when in contact with ECM from pathological cardiac fibroblasts. These results provide novel insights into the bidirectional interplay between cardiac ECM and CPCs, potentially affecting CPC biology and regenerative potential.

Highlights

Despite remarkable progress in early diagnosis and prevention, heart failure (HF) is still the leading cause of death in Western countries [1]
The aim of the present study is to investigate in vitro the molecular and functional effects elicited on cardiac progenitor cells (CPCs) phenotype when cultured on cardiac fibroblast-derived extracellular matrix (ECM) substrates, in order to better understand the interactions between ECM components and a suitable cell product candidate for heart regenerative therapy, as well as to improve experimental protocols
We observed a significant increase in the expression of the cardiac-specific transcription factor NK2 homeobox 5 (NKX2-5) in both CGs and control (Figure 1(a)), suggesting that the cells are GAPDH fw GAPDH rv Nkx2.5 fw Nkx2.5 rv GATA-4 fw GATA-4 rv Cx43 Fw Cx43 Rv Thy-1 fw Thy-1 rv ACTC1 fw ACTC1 rv TTN fw TTN rv CTNNB1 fw CTNNB1 rv Snai1 fw Snai1 rv TGFBR2 fw TGFBR2 rv Vim rv Vim fw ACTA1fw ACTA1 rv KDR fw KDR rv ACAGTCAGCCGCATCTTC GCCCAATACGACCAAATCC GGTGGAGCTGGAGAAGACAGA CGCCGCTCCAGTTCATAG GTTTTTTCCCCTTTGATTTTTGATC AACGACGGCAACAACGATAAT AGGAGTTCAATCACTTGGCG GAGTTTGCCTAAGGCGCTC

Summary

Introduction

Despite remarkable progress in early diagnosis and prevention, heart failure (HF) is still the leading cause of death in Western countries [1]. Heart transplantation could be considered the only effective therapeutic strategy for end-stage HF patients, albeit limited by organ availability and immunological issues. Research has been focused on the development of alternative therapies able to repair a damaged heart and restore its function. Resident cardiac progenitor cells (CPCs) can be isolated with several protocols [4] yielding mesenchymallike cell populations sharing similar transcriptomic profiles [5]. Human CPCs can be isolated with clinically compliant protocols [6] and have been tested in few clinical trials as a promising tool for cardiac regenerative medicine [7, 8]. Despite the positive preclinical results [9, 10], regenerative medicine still cannot be considered a strong alternative to transplantation.

Objectives

Methods

Results

Conclusion