NMR assignment of non-modified tRNAIle from Escherichia coli

Vanessa De Jesus,Boris Fürtig,Jennifer Vögele,Thomas Biedenbänder,Jens Wöhnert

doi:10.1007/s12104-022-10075-6

Vanessa De Jesus, Boris Fürtig + Show 3 more

Open Access

https://doi.org/10.1007/s12104-022-10075-6

Copy DOI

Abstract

tRNAs are L-shaped RNA molecules of ~ 80 nucleotides that are responsible for decoding the mRNA and for the incorporation of the correct amino acid into the growing peptidyl-chain at the ribosome. They occur in all kingdoms of life and both their functions, and their structure are highly conserved. The L-shaped tertiary structure is based on a cloverleaf-like secondary structure that consists of four base paired stems connected by three to four loops. The anticodon base triplet, which is complementary to the sequence of the mRNA, resides in the anticodon loop whereas the amino acid is attached to the sequence CCA at the 3′-terminus of the molecule. tRNAs exhibit very stable secondary and tertiary structures and contain up to 10% modified nucleotides. However, their structure and function can also be maintained in the absence of nucleotide modifications. Here, we present the assignments of nucleobase resonances of the non-modified 77 nt tRNAIle from the gram-negative bacterium Escherichia coli. We obtained assignments for all imino resonances visible in the spectra of the tRNA as well as for additional exchangeable and non-exchangeable protons and for heteronuclei of the nucleobases. Based on these assignments we could determine the chemical shift differences between modified and non-modified tRNAIle as a first step towards the analysis of the effect of nucleotide modifications on tRNA’s structure and dynamics.

Highlights

Biological context tRNA molecules play a central role in translation by decoding the information on the mRNA into a sequence of amino acids
The secondary structure of tRNA is divided into five parts: the acceptor stem (Acc. stem), the dihydrouridine arm (D-arm), the
TRNAs constitute the class of RNAs with the highest modification rate and more than three quarters of all known types of modified nucleotides are found within their sequences (Boccaletto et al 2018)

Summary

Sample preparation

The DNA template of 77 nt tRNAIle from Escherichia coli is flanked by two restriction sites and a hammerhead ribozyme: GAATT (EcoRI)—TAATACGACTCACTATAG(T7 promotor)—GGACAAGCCTCTGATGAGTCCGTGAGGACGAAAGACCGTCTTCGGACGGTCTC (hammerhead ribozyme)—AGGCTTGTAGCTCAGGTGGTTAGAGCGCACCCCTGATAAGGGTGAGGTCGGTGGTTCAAGTCCACTCAGGCCTACCA (tRNAIle)—TATG (NdeI). Plasmid DNA and primer were purchased from Eurofins Genomics (Ebersberg, Germany). DNA was amplified by polymerase chain reaction (PCR) using T7 forward primer (5′-TAATACGACTCACTATAGG-3′) and tRNAIle reverse primer (5′-TGGTGCCCGGACTCG-3′). 13C-15N-labeled 77 nt tRNAIle was synthesized by in vitro transcription with T7 RNA polymerase from the PCR product as described in literature (Fürtig et al 2003; Guilleres et al 2005). The 13C-15N-labeled (rATP, rCTP, rGTP, rUTP) nucleotides for transcription were purchased from Silantes (Munich, Germany). TRNAIle was purified by preparative polyacrylamide gel electrophoresis according to standard protocols (Bains et al 2019). The tRNAIle was folded in water by heat denaturation for 5 min at 95 °C and immediately diluted tenfold with ice-cold water. Afterwards, tRNAIle was buffer-exchanged into NMR buffer (25 mM potassium phosphate, 200 mM KCl, 5 mM MgCl2, pH 6.2)

NMR spectroscopy

Acquisition time Points

Findings

Extent of assignment and data deposition