Next-Generation Sequencing Identifies the Keratinocyte-Specific miRNA Signature of Psoriasis

Abstract

Psoriasis is the most common immune-mediated skin disease in adults (Lowes et al., 2014Lowes M.A. Suárez-Fariñas M. Krueger J.G. Immunology of psoriasis.Annu Rev Immunol. 2014; 32: 227-255Crossref PubMed Scopus (982) Google Scholar), in which the disturbed interplay between keratinocytes and immune cells leads to chronic skin inflammation (Lowes et al., 2014Lowes M.A. Suárez-Fariñas M. Krueger J.G. Immunology of psoriasis.Annu Rev Immunol. 2014; 32: 227-255Crossref PubMed Scopus (982) Google Scholar). Conventionally, keratinocytes were thought to be passive bystanders; however, recent research suggests their active involvement in the disease (Lowes et al., 2014Lowes M.A. Suárez-Fariñas M. Krueger J.G. Immunology of psoriasis.Annu Rev Immunol. 2014; 32: 227-255Crossref PubMed Scopus (982) Google Scholar, Swindell et al., 2011Swindell W.R. Johnston A. Carbajal S. Han G. Wohn C. Lu J. et al.Genome-wide expression profiling of five mouse models identifies similarities and differences with human psoriasis.PLOS ONE. 2011; 6: e18266Crossref PubMed Scopus (142) Google Scholar). In psoriasis, keratinocytes act as an amplifier of skin inflammation by producing antimicrobial peptides, cytokines, and chemokines (Lowes et al., 2014Lowes M.A. Suárez-Fariñas M. Krueger J.G. Immunology of psoriasis.Annu Rev Immunol. 2014; 32: 227-255Crossref PubMed Scopus (982) Google Scholar). MicroRNAs (miRNAs) are short noncoding RNAs that regulate gene expression at the post-transcriptional level (Bartel, 2009Bartel D.P. MicroRNAs: target recognition and regulatory functions.Cell. 2009; 136: 215-233Abstract Full Text Full Text PDF PubMed Scopus (15907) Google Scholar). We and others have shown altered miRNA expression profiles in psoriatic skin (Joyce et al., 2011Joyce C.E. Zhou X. Xia J. Ryan C. Thrash B. Menter A. et al.Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome.Hum Mol Genet. 2011; 20: 4025-4040Crossref PubMed Scopus (145) Google Scholar, Løvendorf et al., 2015Løvendorf M.B. Mitsui H. Zibert J.R. Røpke M.A. Hafner M. Dyring-Andersen B. et al.Laser capture microdissection followed by next-generation sequencing identifies disease-related microRNAs in psoriatic skin that reflect systemic microRNA changes in psoriasis.Exp Dermatol. 2015; 24: 187-193Crossref PubMed Scopus (32) Google Scholar, Sonkoly et al., 2007Sonkoly E. Wei T. Janson P.C. Sääf A. Lundeberg L. Tengvall-Linder M. et al.MicroRNAs: novel regulators involved in the pathogenesis of psoriasis?.PLOS ONE. 2007; 2: e610Crossref PubMed Scopus (520) Google Scholar, Zibert et al., 2010Zibert J.R. Løvendorf M.B. Litman T. Olsen J. Kaczkowski B. Skov L. MicroRNAs and potential target interactions in psoriasis.J Dermatol Sci. 2010; 58: 177-185Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar), and several of the identified miRNAs have been shown to regulate cellular functions relevant to psoriasis (Meisgen et al., 2012Meisgen F. Xu N. Wei T. Janson P.C. Obad S. Broom O. et al.MiR-21 is up-regulated in psoriasis and suppresses T cell apoptosis.Exp Dermatol. 2012; 21: 312-314Crossref PubMed Scopus (129) Google Scholar, Srivastava et al., 2017Srivastava A. Nikamo P. Lohcharoenkal W. Li D. Meisgen F. Xu Landén N. et al.MicroRNA-146a suppresses IL-17-mediated skin inflammation and is genetically associated with psoriasis.J Allergy Clin Immunol. 2017; 139: 550-561Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar, Xu et al., 2011Xu N. Brodin P. Wei T. Meisgen F. Eidsmo L. Nagy N. et al.MiR-125b, a microRNA downregulated in psoriasis, modulates keratinocyte proliferation by targeting FGFR2.J Invest Dermatol. 2011; 131: 1521-1529Abstract Full Text Full Text PDF PubMed Scopus (174) Google Scholar, Xu et al., 2013Xu N. Meisgen F. Butler L.M. Han G. Wang X.J. Söderberg-Nauclér C. et al.MicroRNA-31 is overexpressed in psoriasis and modulates inflammatory cytokine and chemokine production in keratinocytes via targeting serine/threonine kinase 40.J Immunol. 2013; 190: 678-688Crossref PubMed Scopus (157) Google Scholar). However, a common limitation of all previous studies characterizing global miRNA expression in psoriasis is that they used full-depth skin biopsies (Joyce et al., 2011Joyce C.E. Zhou X. Xia J. Ryan C. Thrash B. Menter A. et al.Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome.Hum Mol Genet. 2011; 20: 4025-4040Crossref PubMed Scopus (145) Google Scholar, Sonkoly et al., 2007Sonkoly E. Wei T. Janson P.C. Sääf A. Lundeberg L. Tengvall-Linder M. et al.MicroRNAs: novel regulators involved in the pathogenesis of psoriasis?.PLOS ONE. 2007; 2: e610Crossref PubMed Scopus (520) Google Scholar, Zibert et al., 2010Zibert J.R. Løvendorf M.B. Litman T. Olsen J. Kaczkowski B. Skov L. MicroRNAs and potential target interactions in psoriasis.J Dermatol Sci. 2010; 58: 177-185Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar) or microdissected epidermis (Løvendorf et al., 2015Løvendorf M.B. Mitsui H. Zibert J.R. Røpke M.A. Hafner M. Dyring-Andersen B. et al.Laser capture microdissection followed by next-generation sequencing identifies disease-related microRNAs in psoriatic skin that reflect systemic microRNA changes in psoriasis.Exp Dermatol. 2015; 24: 187-193Crossref PubMed Scopus (32) Google Scholar) containing a mix of different stromal and infiltrating cell types. Although these approaches led to important discoveries, cell type–specific alterations in miRNA levels were potentially masked in the complex tissue containing different cell types. To understand the contribution of miRNAs to the epidermal alterations in psoriasis, we aimed to identify alterations in the keratinocyte miRNome in psoriasis. To this end, keratinocytes were sorted from lesional and nonlesional skin of patients with psoriasis (n = 9), as well as from healthy donors (n = 9), by the separation of the epidermis followed by magnetic sorting of CD45neg cells (Supplementary Figure S1). All donors provided written informed consent for this study. Using this approach, we could exclude not only dermal cells but also intraepidermal immune cells that are present in large numbers in the psoriatic epidermis (Lowes et al., 2014Lowes M.A. Suárez-Fariñas M. Krueger J.G. Immunology of psoriasis.Annu Rev Immunol. 2014; 32: 227-255Crossref PubMed Scopus (982) Google Scholar, Pasquali et al., 2019Pasquali L. Srivastava A. Meisgen F. Das Mahapatra K. Xia P. Xu Landén N. et al.The keratinocyte transcriptome in psoriasis: pathways related to immune responses, cell cycle and keratinization.Acta Derm Venereol. 2019; 99: 196-205Crossref PubMed Scopus (37) Google Scholar). Small RNA sequencing demonstrated robust expression of 411 known and 30 novel miRNAs (transcripts per million > 1 in >50% of the samples in at least one of the groups) (NCBI GEO, accession number: GSE129373). Analysis of miRNA isoforms that differ on the 3′ or 5′ end showed an increased heterogeneity at the 3′ end of the expressed miRNAs (3′ deletion and 3′ addition) compared with the 5′ end. Isoforms of miRNAs with decreased length at the 3′ end were significantly more frequently detected in psoriatic keratinocytes, whereas isoforms of miRNAs with increased length at the 3′ end were less frequent, suggesting possible alterations in processing in psoriatic keratinocytes (Supplementary Figure S2). Using edgeR software, we identified 104 miRNAs with significantly altered level (fold change > 1.4, false discovery rate < 0.1) between healthy and psoriatic keratinocytes (lesional vs. healthy skin), out of which 66 were upregulated and 38 were downregulated (Figure 1a–c, Supplementary Table S1). Pair-wise comparison of miRNA expression in keratinocytes from nonlesional and lesional psoriatic skin (lesional vs. nonlesional skin) identified 87 deregulated miRNAs (Supplementary Figure S3a–c, Supplementary Table S2). Comparison of the miRNome of keratinocytes from nonlesional skin of patients with psoriasis to healthy keratinocytes identified seven differentially expressed miRNAs (Supplementary Table S3), suggesting intrinsic changes already in keratinocytes of the nonlesional psoriatic skin. Several abundant miRNA families were differentially expressed in psoriatic keratinocytes (Supplementary Figure S4). In addition to confirming the deregulated expression of several of the miRNAs previously associated with psoriasis (e.g., miR-21, miR-31, miR-146a, miR-125b, and miR-99a; Figure 1a), our analysis identified a surprisingly large number of miRNAs (32 upregulated and 18 downregulated miRNAs in the lesional vs. healthy comparison and 36 upregulated and 18 downregulated miRNAs in the lesional vs. nonlesional comparison) that were not identified in previous studies using full-depth biopsies or microdissected epidermis (Joyce et al., 2011Joyce C.E. Zhou X. Xia J. Ryan C. Thrash B. Menter A. et al.Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome.Hum Mol Genet. 2011; 20: 4025-4040Crossref PubMed Scopus (145) Google Scholar, Løvendorf et al., 2015Løvendorf M.B. Mitsui H. Zibert J.R. Røpke M.A. Hafner M. Dyring-Andersen B. et al.Laser capture microdissection followed by next-generation sequencing identifies disease-related microRNAs in psoriatic skin that reflect systemic microRNA changes in psoriasis.Exp Dermatol. 2015; 24: 187-193Crossref PubMed Scopus (32) Google Scholar, Sonkoly et al., 2007Sonkoly E. Wei T. Janson P.C. Sääf A. Lundeberg L. Tengvall-Linder M. et al.MicroRNAs: novel regulators involved in the pathogenesis of psoriasis?.PLOS ONE. 2007; 2: e610Crossref PubMed Scopus (520) Google Scholar, Zibert et al., 2010Zibert J.R. Løvendorf M.B. Litman T. Olsen J. Kaczkowski B. Skov L. MicroRNAs and potential target interactions in psoriasis.J Dermatol Sci. 2010; 58: 177-185Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar) (Supplementary Figure S5a–d, Supplementary Tables S4a-b and S5a-b. In addition, we also identified 11 novel miRNAs whose level was altered in psoriatic keratinocytes (Supplementary Table S6). Analysis of the genetic localization of miRNAs differentially expressed in psoriatic keratinocytes revealed that the genes for several of them (miR-146a-5p, miR-141-5p, miR-944, and miR-211-5p) were localized near to (±500 kilobases) previously identified psoriasis-associated single nucleotide polymorphisms (Stuart et al., 2015Stuart P.E. Nair R.P. Tsoi L.C. Tejasvi T. Das S. Kang H.M. et al.Genome-wide Association Analysis of Psoriatic Arthritis and Cutaneous Psoriasis Reveals Differences in Their Genetic Architecture.Am J Hum Genet. 2015; 97: 816-836Abstract Full Text Full Text PDF PubMed Google Scholar, Tsoi et al., 2017Tsoi L.C. Stuart P.E. Tian C. Gudjonsson J.E. Das S. Zawistowski M. et al.Large scale meta-analysis characterizes genetic architecture for common psoriasis associated variants.Nat Commun. 2017; 8: 15382Crossref PubMed Scopus (60) Google Scholar) (Supplementary Table S7), suggesting that genetic variations may contribute to changes in miRNA expression in psoriatic keratinocytes. Next, we selected two miRNAs overexpressed in psoriatic keratinocytes for validation: miR-941, a miRNA previously not identified in psoriasis, and miR-1307-3p, a miRNA previously not characterized in psoriasis (Supplementary Figure S6, Figure 2a). Quantitative real-time reverse transcriptase–PCR analysis in an extended validation cohort confirmed the increased expression of both miR-941 and miR-1307-3p in psoriatic keratinocytes compared with healthy and nonlesional keratinocytes (Supplementary Figure S6, Figure 2a). The increased expression and the epidermal localization of miR-1307-3p in psoriasis was further validated by in situ hybridization (Figure 2b). Next, we investigated the regulation of miR-1307-3p by psoriasis-associated cytokines in monolayer cultures and in three-dimensional epidermal equivalents. IL-1β, IL-17A, and IL-22 significantly induced miR-1307-3p expression both in cultured keratinocytes (Figure 2c) and in three-dimensional epidermal equivalents (Figure 2d). Next, to explore its function in the context of inflammation, miR-1307-3p was overexpressed in keratinocytes followed by analysis of the expression of the inflammatory mediators IL-8, IL-6, and CCL20. Quantitative real-time reverse transcriptase–PCR results showed that miR-1307-3p significantly induced the expression of IL-8, IL-6, and CCL20 (Figure 2e). Collectively, our results suggest that miR-1307-3p is part of an inflammatory loop that can enhance inflammatory responses in keratinocytes in psoriasis. This study provides a comprehensive landscape of miRNAs in sorted epidermal cells of psoriatic skin and identifies several miRNAs previously not associated with the disease. Our sorting strategy excluded epidermal immune cells, and although the contribution of CD45neg cells such as melanocytes cannot be excluded completely, the expression of cell specific markers (Pasquali et al., 2019Pasquali L. Srivastava A. Meisgen F. Das Mahapatra K. Xia P. Xu Landén N. et al.The keratinocyte transcriptome in psoriasis: pathways related to immune responses, cell cycle and keratinization.Acta Derm Venereol. 2019; 99: 196-205Crossref PubMed Scopus (37) Google Scholar) suggests that most of the observed changes in miRNA expression were derived from keratinocytes. Our results may serve as the basis for future functional studies of miRNAs deregulated in keratinocytes in psoriasis. Datasets related to this article with small RNA sequencing data are openly available at NCBI GEO (https://www.ncbi.nlm.nih.gov/geo/), accession number GSE129373. Ankit, Srivastava: https://orcid.org/0000-0001-5328-7509 Florian, Meisgen: https://orcid.org/0000-0001-5359-3821 Lorenzo, Pasquali: https://orcid.org/0000-0003-2416-5531 Sara, Munkhammar: https://orcid.org/0000-0002-5164-1575 Ping, Xia: https://orcid.org/0000-0002-4806-8843 Mona, Ståhle: https://orcid.org/0000-0002-3916-9343 Ning, Xu Landén: https://orcid.org/0000-0003-4868-3798 Andor, Pivarcsi: https://orcid.org/0000-0003-2196-1102 Enikö, Sonkoly: https://orcid.org/0000-0002-4909-5413 The authors state no conflict of interest. We express our gratitude to all the patients and control subjects who contributed to this study. We also thank Anna-Lena Kastman and research nurses Helena Griehsel and Maria Lundqvist for their excellent technical support. This work was supported by the Swedish Skin Foundation (Hudfonden), the Swedish Research Council (Vetenskapsrådet), the Swedish Psoriasis Foundation (Psoriasisfonden), and the Stockholm County Council (SLL, ALF). Conceptualization: AP, ES; Data Curation: AS, FM; Formal Analysis: AS, FM, LP, SM, PX; Funding Acquisition: ES; Investigation: AS, FM, LP, SM, PX, NXL; Methodology: AS, FM, LP, SM, PX; Project Administration: AP, ES; Resources: MS, ES; Supervision: ES, NXL; Validation: AS, LP, PX; Visualization: FM, AS, LP; Writing - Original Draft Preparation: AS, AP, ES; Writing - Review and Editing: AS, FM, LP, SM, PX, MS, NXL, AP, ES. Full-depth punch biopsies (4 mm) were collected from lesional (n = 19) and nonlesional (n = 19) skin of patients with psoriasis and age-matched healthy controls (n = 19). All patients were examined by a dermatologist for chronic plaque psoriasis, and Psoriasis Area Severity Index score was determined at the time of skin sample collection. Patients were untreated or had a drug washout period of at least 2 weeks for topical treatments and 4 weeks for systemic treatments. All the patients and healthy controls included in the study were of Caucasian origin. The study was approved by a regional ethical committee, and all the procedures concerning human subjects were performed according to the Declaration of Helsinki Principles. All the donors gave written informed consent for this study. After dispase treatment (5 U/ml) (Thermo Fisher Scientific, Waltham, MA) for 14–16 hours at 4 °C, epidermis and dermis were separated by forceps. Epidermal sheets were treated with trypsin-EDTA (Thermo Fisher Scientific) for 15 minutes at 37 °C to obtain single cell suspension. The cell suspensions were incubated with magnetic CD45pos microbeads at 4 °C for 15 minutes (Miltenyi Biotec, Bergisch Gladbach, Germany). CD45neg cell populations (predominantly keratinocytes) were isolated by negative selection using magnetic activated cell sorting according to the manufacturer’s instructions (Supplementary Figure S1). Total RNA was isolated from the CD45neg cell fraction using the miRNeasy mini kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol. RNA quantity and integrity (RNA integrity number) was assessed using an Agilent 2100 Bioanalyzer chip (Agilent, Santa Clara, CA). All RNA samples used for microRNA (miRNA) sequencing and quantitative real-time reverse transcriptase–PCR had an RNA integrity number > 9.0. Next-generation sequencing for small RNAs was performed at Beijing Genomics Institute, China. Adapters and the low-quality tags were removed from the sequencing data. Clean reads were mapped and aligned to known miRNA sequences (miRBase 21). Novel miRNA transcripts were predicted based on the length (22–25 nucleotides) and secondary structure (precursor analysis) using MIREAP and mapped to the human genome. Data were normalized (transcripts per million) and analyzed using Bioconductor-edgeR. Group comparisons (lesional vs. healthy, lesional vs. non lesional, and nonlesional vs. healthy) were performed. miRNAs with <10% false discovery rate and fold change > 1.4 (1 transcript per million at least in one of the groups and expressed in half of the samples in any group) were considered statistically significant. To find miRNAs located in psoriasis susceptibility loci, differentially expressed miRNAs located in genomic regions ±500 kilobases of psoriasis-associated single nucleotide polymorphisms (Stuart et al., 2015Stuart P.E. Nair R.P. Tsoi L.C. Tejasvi T. Das S. Kang H.M. et al.Genome-wide Association Analysis of Psoriatic Arthritis and Cutaneous Psoriasis Reveals Differences in Their Genetic Architecture.Am J Hum Genet. 2015; 97: 816-836Abstract Full Text Full Text PDF PubMed Google Scholar, Tsoi et al., 2012Tsoi L.C. Spain S.L. Knight J. Ellinghaus E. Stuart P.E. Capon F. et al.Identification of 15 new psoriasis susceptibility loci highlights the role of innate immunity.Nat Genet. 2012; 44: 1341-1348Crossref PubMed Scopus (707) Google Scholar, Tsoi et al., 2017Tsoi L.C. Stuart P.E. Tian C. Gudjonsson J.E. Das S. Zawistowski M. et al.Large scale meta-analysis characterizes genetic architecture for common psoriasis associated variants.Nat Commun. 2017; 8: 15382Crossref PubMed Scopus (60) Google Scholar). For comparison with previous studies, lists of differentially expressed miRNAs in psoriasis were obtained from previous literature (Joyce et al., 2011Joyce C.E. Zhou X. Xia J. Ryan C. Thrash B. Menter A. et al.Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome.Hum Mol Genet. 2011; 20: 4025-4040Crossref PubMed Scopus (145) Google Scholar, Løvendorf et al., 2015Løvendorf M.B. Mitsui H. Zibert J.R. Røpke M.A. Hafner M. Dyring-Andersen B. et al.Laser capture microdissection followed by next-generation sequencing identifies disease-related microRNAs in psoriatic skin that reflect systemic microRNA changes in psoriasis.Exp Dermatol. 2015; 24: 187-193Crossref PubMed Scopus (32) Google Scholar, Sonkoly et al., 2007Sonkoly E. Wei T. Janson P.C. Sääf A. Lundeberg L. Tengvall-Linder M. et al.MicroRNAs: novel regulators involved in the pathogenesis of psoriasis?.PLOS ONE. 2007; 2: e610Crossref PubMed Scopus (520) Google Scholar, Zibert et al., 2010Zibert J.R. Løvendorf M.B. Litman T. Olsen J. Kaczkowski B. Skov L. MicroRNAs and potential target interactions in psoriasis.J Dermatol Sci. 2010; 58: 177-185Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar), and an intersection analysis was performed with our list of differentially expressed miRNAs. Total RNA was reverse transcribed using TaqMan MicroRNA Reverse Transcription Kit (Thermo Fisher Scientific) using specific primers for miR-941 and miR-1307-3p or RNU48. The cDNA was amplified by real-time PCR QuantStudio 7 Flex Real-Time PCR System (Thermo Fisher Scientific). The expression of miR-941 and miR-1307-3p was normalized against RNU48 (Thermo Fisher Scientific) using the ΔΔct-method. The expression of IL-6, IL-8, and CCL20 was analyzed using TaqMan-based predesigned quantitative PCR assays (Integrated DNA Technologies, Coralville, IA) and normalized to 18S (18S fwd: CGGCTACCACATCCAAGGAA; rev: GCTGGAATTACCGCGGCT, probe: TGCTGGCACCAGACTTGCCCTC) using the ΔΔct-method. In situ hybridization for miR-1307 was performed using 7 μm thick formalin-fixed paraffin-embedded skin sections from healthy volunteers and patients with psoriasis. Skin sections were deparaffinized and treated with proteinase K (20 μg/ml) (Thermo Fisher Scientific) and incubated with miR-1307 and scramble probe (double digoxigenin; Qiagen) overnight at 52 °C. The next day, sections were washed with saline–sodium citrate buffer (Thermo Fisher Scientific) and incubated with alkaline phosphatase-conjugated sheep antidigoxigenin Fab fragments (1:800; Roche, Basel, Switzerland) for 1 hour at room temperature. Antibody-conjugated probe signal was developed with BM purple alkaline phosphatase substrate (Roche). Human primary keratinocytes were purchased from Thermo Fisher Scientific and cultured in EpiLife medium (Thermo Fisher Scientific) containing HKGS Growth Supplement (Thermo Fisher Scientific) and penicillin/streptomycin (Thermo Fisher Scientific) at 37 °C in 5% CO2. Keratinocytes were treated with IL-22 (20 ng/ml), IFN-γ (20 ng/ml), IL-1β (10 ng/ml), and IL-17A (100 ng/ml) (R&D Systems, Minneapolis, MN) for 48 hours, and total RNA was isolated. Three-dimensional epidermal equivalents were obtained from MatTek (Ashland, MA) and cultured according to manufacturer’s instructions. IL-1β, IL-17A, and IL-22 (20 ng/ml) (R&D Systems) added to the cultured three-dimensional epidermal equivalents for 72 hours, and total RNA was harvested and miR-1307 expression was analyzed using quantitative real-time reverse transcriptase–PCR. To overexpress miR-1307-3p, primary human keratinocytes were transfected with miR-1307-3p synthetic mimics or corresponding control (Thermo Fisher Scientific). For statistical comparison of groups, Mann–Whitney U test was performed (GraphPad Prism, La Jolla, CA). P < 0.05 was considered significant.Supplementary Figure S23′ heterogeneity in isoforms of miRNAs. Clean reads of the miRNAs were normalized, and heterogeneity in miRNAs was detected. Graph depicts heterogeneity in canonical miRNAs at different position of 5′ and 3′ end along with total length. ∗∗∗∗P < 0.0001 (Mann–Whitney U test). miRNA, microRNA.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Supplementary Figure S3miRNAs differentially expressed between keratinocytes from psoriatic lesional and nonlesional skin. (a) Unsupervised hierarchical clustering and heatmap for 87 differentially expressed miRNAs between keratinocytes from PP and PN skin (FDR < 0.1; H, n = 9; PN, n = 9; PP, n = 9). Data are presented as log2-transformed fold changes. (b) The top 30 upregulated miRNAs in the PP versus PN comparison. (c) The top 30 downregulated miRNAs in the PP versus PN comparison. FDR, false discovery rate; H, healthy; miRNA, microRNA; PN, psoriatic nonlesional; PP, psoriatic lesional.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Supplementary Figure S4Most abundant differentially expressed miRNA families. Top 10 most abundant differentially expressed miRNA families in PP versus H, PP versus PN, and PN versus H group comparisons. H, healthy; miRNA, microRNA; PN, psoriatic nonlesional; PP, psoriatic lesional.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Supplementary Figure S5Comparison of miRNA signatures in psoriasis identified by the present and previous studies. Lists of differentially expressed miRNAs were obtained from previous publications (Joyce et al., 2011Joyce C.E. Zhou X. Xia J. Ryan C. Thrash B. Menter A. et al.Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome.Hum Mol Genet. 2011; 20: 4025-4040Crossref PubMed Scopus (145) Google Scholar, Løvendorf et al., 2015Løvendorf M.B. Mitsui H. Zibert J.R. Røpke M.A. Hafner M. Dyring-Andersen B. et al.Laser capture microdissection followed by next-generation sequencing identifies disease-related microRNAs in psoriatic skin that reflect systemic microRNA changes in psoriasis.Exp Dermatol. 2015; 24: 187-193Crossref PubMed Scopus (32) Google Scholar, Sonkoly et al., 2007Sonkoly E. Wei T. Janson P.C. Sääf A. Lundeberg L. Tengvall-Linder M. et al.MicroRNAs: novel regulators involved in the pathogenesis of psoriasis?.PLOS ONE. 2007; 2: e610Crossref PubMed Scopus (520) Google Scholar, Zibert et al., 2010Zibert J.R. Løvendorf M.B. Litman T. Olsen J. Kaczkowski B. Skov L. MicroRNAs and potential target interactions in psoriasis.J Dermatol Sci. 2010; 58: 177-185Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar), in which researchers utilized full-depth skin biopsies or laser capture-microdissected epidermis from patients with psoriasis to perform miRNA profiling via microarray or RNA sequencing. (a–d) An intersection was performed with the list of differentially expressed miRNAs in our study using sorted keratinocytes and previous studies (Joyce et al., 2011Joyce C.E. Zhou X. Xia J. Ryan C. Thrash B. Menter A. et al.Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome.Hum Mol Genet. 2011; 20: 4025-4040Crossref PubMed Scopus (145) Google Scholar, Løvendorf et al., 2015Løvendorf M.B. Mitsui H. Zibert J.R. Røpke M.A. Hafner M. Dyring-Andersen B. et al.Laser capture microdissection followed by next-generation sequencing identifies disease-related microRNAs in psoriatic skin that reflect systemic microRNA changes in psoriasis.Exp Dermatol. 2015; 24: 187-193Crossref PubMed Scopus (32) Google Scholar, Sonkoly et al., 2007Sonkoly E. Wei T. Janson P.C. Sääf A. Lundeberg L. Tengvall-Linder M. et al.MicroRNAs: novel regulators involved in the pathogenesis of psoriasis?.PLOS ONE. 2007; 2: e610Crossref PubMed Scopus (520) Google Scholar, Zibert et al., 2010Zibert J.R. Løvendorf M.B. Litman T. Olsen J. Kaczkowski B. Skov L. MicroRNAs and potential target interactions in psoriasis.J Dermatol Sci. 2010; 58: 177-185Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar), in (a, c) PP versus H comparison and (b, d) PP versus PN comparison. H, healthy; miRNA, microRNA; PN, psoriatic nonlesional; PP, psoriatic lesional.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Supplementary Figure S6miR-941 is overexpressed in psoriatic keratinocytes. Left: Expression (transcript per million) of miR-941 detected by small RNA sequencing, in keratinocytes from H (n = 9), PN (n = 9), and PP skin (n = 9). ****P < 0.0001 (Mann–Whitney U test). Right: qRT-PCR expression analysis of miR-941 in an extended cohort; H (n = 19), PN (n = 19), and PP (n = 19). *P < 0.05 (Mann–Whitney U test). H, healthy; miRNA, microRNA; PN, psoriatic nonlesional; PP, psoriatic lesional; qRT-PCR, quantitative real-time reverse transcriptase–PCR.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Supplementary Table S1Differentially Expressed miRNAs in Keratinocytes from Psoriatic Skin Lesions Compared with Keratinocytes from Healthy Donors (Fold Change > 1.4, FDR < 0.1)miRNAPsoriatic Lesional vs HealthyFC (Lin)P-valueFDRnovel_mir_26353325.4824.589E-233.373E-21novel_mir_14961707.6405.501E-070.00001hsa-miR-1247-3p768.0770.000090.00079hsa-miR-1247-5p545.7410.000010.00008novel_mir_1406499.3830.001860.01001novel_mir_2396360.4750.000020.00026hsa-miR-4446-3p360.4400.000690.00449hsa-miR-3065-3p311.7740.000160.00140hsa-miR-3163311.6610.000780.00493hsa-miR-573311.1720.000780.00493hsa-miR-505-3p310.0440.000080.00076novel_mir_1748309.4330.000620.00429hsa-miR-33b-3p240.2870.000360.00293hsa-miR-32-3p204.7070.000980.00590hsa-miR-629-3p182.4740.001390.00797novel_mir_2458144.1600.000070.00071hsa-miR-3200-3p141.8890.002710.01373hsa-miR-106a-5p109.1090.001780.00968novel_mir_90365.9090.002120.01114novel_mir_23847.6460.001460.00825hsa-miR-797436.2722.438E-060.00004hsa-miR-31-5p26.0581.845E-179.041E-16hsa-miR-317621.0730.015320.06314hsa-miR-21-3p17.3513.251E-243.584E-22hsa-miR-187-3p12.2260.017750.07116hsa-miR-18a-5p8.0970.019680.07625hsa-miR-3614-5p7.8690.000070.00071hsa-miR-21-5p6.1461.708E-242.510E-22hsa-miR-146a-5p5.4273.077E-109.047E-09hsa-miR-615-3p4.9460.003230.01582hsa-miR-1307-3p4.4790.000470.00340hsa-miR-92a-1-5p3.7420.017930.07125hsa-miR-1910-5p3.7110.000860.00536hsa-miR-4843.7100.011050.04872hsa-miR-378a-3p3.6942.435E-181.342E-16hsa-miR-9413.6000.000060.00068hsa-miR-345-5p3.3010.001690.00932hsa-miR-4213.1680.000450.00340hsa-let-7a-3p3.1230.012520.05412hsa-miR-501-3p3.1030.000480.00344hsa-miR-378c2.9710.001130.00673hsa-miR-877-5p2.7901.494E-072.995E-06hsa-miR-36152.6810.000010.00011hsa-miR-100-5p2.6490.015290.06314hsa-miR-25-5p2.6370.002290.01190hsa-miR-128-3p2.5620.000690.00449hsa-miR-141-5p2.4520.000040.00045hsa-miR-224-5p2.3043.031E-060.00005hsa-miR-500a-3p2.2660.000350.00292hsa-miR-27b-5p2.2316.418E-070.00001hsa-miR-452-5p2.1980.016240.06630hsa-miR-454-3p2.1840.023750.08872hsa-miR-92b-3p2.03850.000080.00076hsa-miR-17-5p2.03460.001220.00715hsa-miR-200b-3p1.88360.000190.00165hsa-miR-301a-3p1.78890.004420.02052hsa-miR-93-5p1.67660.000120.00109hsa-miR-92a-3p1.60730.000080.00075hsa-miR-27a-5p1.60300.003160.01565hsa-miR-423-3p1.53440.000460.00340hsa-let-7d-3p1.52550.012760.05464hsa-miR-106b-3p1.47870.003480.01685hsa-miR-30e-5p1.44700.008140.03664hsa-miR-191-5p1.42570.002090.01112hsa-miR-222-3p1.39260.018710.07369hsa-miR-22-3p1.33590.023940.08872hsa-miR-149-5p0.53250.000140.00127hsa-let-7a-5p0.49140.000010.00010hsa-miR-99b-5p0.48730.000610.00429hsa-miR-26a-5p0.45831.496E-104.712E-09hsa-miR-130a-3p0.44673.853E-099.996E-08hsa-let-7e-5p0.43811.295E-060.00002hsa-miR-181c-5p0.41130.000010.00012hsa-miR-99a-5p0.40945.714E-091.326E-07hsa-miR-143-3p0.40490.001640.00918hsa-miR-23a-3p0.39884.528E-131.664E-11hsa-miR-151b0.39590.013790.05793hsa-miR-24-3p0.39412.438E-060.00004hsa-miR-508-3p0.37420.000960.00589hsa-miR-101-3p0.35264.113E-091.008E-07hsa-miR-10a-5p0.33480.022620.08595hsa-miR-181b-5p0.32848.079E-122.741E-10hsa-miR-125b-5p0.32284.409E-131.664E-11hsa-miR-625-3p0.32240.000680.00449hsa-miR-30a-5p0.31950.000030.00030hsa-let-7c-5p0.30001.579E-136.961E-12hsa-miR-195-5p0.28980.000470.00340hsa-miR-204-5p0.25030.016770.06783hsa-miR-1468-5p0.21400.000030.00038hsa-miR-30a-3p0.20281.105E-072.320E-06hsa-miR-125a-5p0.19301.451E-219.144E-20hsa-miR-30c-2-3p0.19280.000410.00321hsa-miR-181a-5p0.18979.510E-248.387E-22hsa-miR-328-3p0.16370.003710.01758hsa-miR-6510-3p0.14761.690E-083.726E-07hsa-miR-10b-5p0.13380.000070.00073hsa-miR-4520b-3p0.13220.025210.09266hsa-miR-4520a-3p0.12940.005540.02546hsa-miR-548az-5p0.12310.012060.05265hsa-miR-181a-2-3p0.11565.779E-291.274E-26hsa-miR-3750.10021.405E-376.197E-35hsa-miR-5089-5p0.06540.007030.03198novel_mir_200.00240.000370.00295hsa-miR-44900.00074.980E-101.373E-08Abbreviations: FC, fold change; FDR, false discovery rate; miRNA, microRNA. Open table in a new tab Supplementary Table S2Differentially Expressed miRNAs in Keratinocytes from Psoriatic Skin Lesions Compared with Keratinocytes from Paired Nonlesional Skin (Fold Change > 1.4, FDR < 0.1)miRNAPsoriatic Lesional vs NonlesionalFC (Lin)P-valueFDRnovel_mir_26353241.4397.349E-221.080E-19hsa-miR-1247-5p531.9700.000010.00012hsa-miR-125b-1-3p497.0570.000060.00083hsa-miR-3176371.0270.000110.00137novel_mir_2396351.3880.000020.00038hsa-miR-4446-3p351.3540.000740.00608hsa-miR-3166314.2230.000400.00383novel_mir_670295.3220.003480.02226hsa-miR-218-5p259.3280.002540.01779novel_mir_976252.4630.001610.01167hsa-miR-3177-3p178.5760.005160.02998hsa-miR-629-3p177.8860.001500.01124novel_mir_2458140.5410.000080.00101hsa-miR-3620-5p114.7860.000510.00447novel_mir_23869.8530.000660.00557hsa-miR-106a-5p52.6030.005170.02998hsa-miR-4800-3p52.2760.004250.02601hsa-miR-187-3p41.3490.001060.00816novel_mir_90340.7180.004880.02907hsa-miR-3065-3p23.1540.013440.06585hsa-miR-185-3p22.8830.018640.08465hsa-miR-797415.5430.000140.00158hsa-miR-378a-5p13.9500.014880.07056hsa-miR-31-5p12.2765.872E-122.158E-10hsa-miR-21-3p12.1568.906E-209.819E-18novel_mir_149611.3320.023350.09624hsa-miR-12768.5910.007380.04069hsa-miR-146a-5p8.5587.449E-154.693E-13hsa-miR-374b-3p8.0070.023560.09624hsa-miR-190a-5p6.9140.022860.09624hsa-miR-21-5p4.8661.921E-191.412E-17hsa-miR-1307-3p4.7900.000270.00268hsa-miR-92a-1-5p4.6370.006460.03651hsa-miR-9414.0500.000010.00024hsa-miR-4213.5560.000120.00144hsa-miR-3614-5p3.5510.010750.05576hsa-miR-100-5p3.4800.002140.01524hsa-miR-4843.2080.022980.09624hsa-miR-877-5p3.1296.209E-091.826E-07hsa-miR-3158-3p3.0890.022060.09624hsa-miR-128-3p3.0880.000050.00076hsa-miR-452-5p3.0410.000790.00633hsa-miR-378a-3p2.8282.070E-128.299E-11hsa-miR-378c2.4720.006410.03651hsa-miR-501-3p2.3900.006670.03721hsa-miR-140-3p2.3050.015350.07201hsa-miR-36152.2200.000280.00272hsa-miR-224-5p2.1490.000020.00029hsa-miR-9442.1230.018380.08444hsa-miR-27b-5p2.0690.000010.00012hsa-miR-200b-3p1.8840.000190.00208hsa-miR-106b-5p1.8220.009420.05066hsa-miR-92b-3p1.7930.001180.00899hsa-miR-500a-3p1.7840.010870.05576hsa-miR-17-5p1.7680.009150.04981hsa-miR-141-5p1.7480.009770.05190hsa-miR-211-5p0.4860.003320.02152hsa-miR-181c-5p0.4760.000190.00208hsa-miR-509-3p0.4740.002680.01844hsa-miR-99a-5p0.4634.651E-070.00001hsa-miR-195-5p0.4540.023570.09624hsa-miR-101-3p0.4530.000010.00012hsa-miR-24-3p0.4490.000050.00069hsa-miR-1468-5p0.4390.022450.09624hsa-miR-23a-3p0.4302.657E-118.370E-10hsa-miR-193b-3p0.4100.000010.00012hsa-miR-508-3p0.3660.000740.00608hsa-miR-30a-5p0.3630.000170.00189hsa-miR-486-5p0.3610.012060.06112hsa-let-7c-5p0.3382.477E-118.370E-10hsa-miR-181b-5p0.3161.651E-127.280E-11hsa-miR-625-3p0.3090.000450.00418hsa-miR-125b-5p0.3053.241E-141.787E-12hsa-miR-125a-5p0.2827.918E-143.880E-12hsa-miR-6510-3p0.2540.000030.00048hsa-miR-30a-3p0.2351.233E-060.00003hsa-miR-181a-5p0.2261.247E-191.100E-17hsa-miR-30c-2-3p0.2170.000980.00774hsa-miR-10b-5p0.2100.001570.01154hsa-miR-204-5p0.1870.004310.02601hsa-miR-3750.1481.346E-275.938E-25hsa-miR-181a-2-3p0.1323.480E-267.674E-24hsa-miR-150-5p0.1240.000010.00015hsa-miR-885-5p0.1190.003940.02446hsa-miR-138-1-3p0.0460.003660.02305hsa-miR-5089-5p0.0450.002800.01870hsa-miR-44900.0022.188E-086.032E-07Abbreviations: FC, fold change; FDR, false discovery rate; miRNA, microRNA. Open table in a new tab Supplementary Table S3Differentially Expressed miRNAs in Keratinocytes from Nonlesional Skin of Patients with Psoriasis Compared with Keratinocytes from Skin of Healthy Donors (Fold Change > 1.4, FDR < 0.1)miRNAPsoriatic Nonlesional vs HealthyFC (Lin)P-valueFDRhsa-miR-505-3p330.8050.000070.02960hsa-miR-1247-3p170.3720.001050.06604novel _mir _1496129.4210.000230.03365hsa-miR-193b-3p1.9810.000460.04241hsa-miR-31660.0050.000940.06604hsa-miR-4800-3p0.0030.000130.02960novel _mir_200.0030.000480.04241Abbreviations: FC, fold change; FDR, false discovery rate; miRNA, microRNA; PN, psoriatic nonlesional; H, healthy. Open table in a new tab Supplementary Table S4MiRNAs Differentially Expressed in Keratinocytes from Psoriasis Lesions Versus Keratinocytes from Healthy Skin Not Identified in Previous Studies Showing Global miRNA Expression in Psoriatic Skin/Epidermis. Upregulated miRNAs and downregulated miRNAs in the PP versus H comparison, which were not identified in previous publications (Joyce et al., 2011Joyce C.E. Zhou X. Xia J. Ryan C. Thrash B. Menter A. et al.Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome.Hum Mol Genet. 2011; 20: 4025-4040Crossref PubMed Scopus (145) Google Scholar, Sonkoly et al., 2007Sonkoly E. Wei T. Janson P.C. Sääf A. Lundeberg L. Tengvall-Linder M. et al.MicroRNAs: novel regulators involved in the pathogenesis of psoriasis?.PLOS ONE. 2007; 2: e610Crossref PubMed Scopus (520) Google Scholar, Zibert et al., 2010Zibert J.R. Løvendorf M.B. Litman T. Olsen J. Kaczkowski B. Skov L. MicroRNAs and potential target interactions in psoriasis.J Dermatol Sci. 2010; 58: 177-185Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar) as differentially expressed in psoriatic skin/epidermismiRNAFC (Lin)P-valueFDRUpregulated novel_mir_26353325.4824.589E-233.373E-21 novel_mir_14961707.6400.0000010.000011 hsa-miR-1247-5p545.7410.0000050.000079 novel_mir_1406499.3830.0018610.010010 novel_mir_2396360.4750.0000220.000265 hsa-miR-4446-3p360.4400.0006920.004491 hsa-miR-3163311.6610.0007770.004928 hsa-miR-573311.1720.0007820.004928 hsa-miR-505-3p310.0440.0000810.000762 novel_mir_1748309.4330.0006220.004289 novel_mir_2458144.1600.0000670.000707 hsa-miR-3200-3p141.8890.0027090.013734 novel_mir_90365.9090.0021210.011137 novel_mir_23847.6460.0014590.008250 hsa-miR-797436.2720.0000020.000040 hsa-miR-3614-5p7.8690.0000690.000707 hsa-miR-615-3p4.9460.0032280.015816 hsa-miR-1910-5p3.7110.0008630.005360 hsa-miR-4843.7100.0110480.048721 hsa-miR-378a-3p3.6940.0000000.000000 hsa-miR-9413.6000.0000620.000679 hsa-miR-345-5p3.3010.0016900.009316 hsa-miR-36152.6810.0000080.000111 hsa-miR-100-5p2.6490.0152860.063141 hsa-miR-128-3p2.5620.0006860.004491 hsa-miR-500a-3p2.2660.0003510.002919 hsa-miR-452-5p2.1980.0162360.066299 hsa-miR-92b-3p2.0390.0000800.000762 hsa-miR-200b-3p1.8840.0001940.001645 hsa-miR-92a-3p1.6070.0000760.000748 hsa-miR-423-3p1.5340.0004600.003397 hsa-let-7d-3p1.5250.0127620.054643Downregulated hsa-miR-44900.0014.98E-101.37E-08 novel_mir_200.0020.0003750.002952 hsa-miR-5089-5p0.0650.0070340.031980 hsa-miR-548az-5p0.1230.0120580.052650 hsa-miR-4520a-3p0.1290.0055420.025459 hsa-miR-4520b-3p0.1320.0252140.092660 hsa-miR-6510-3p0.1481.69E-083.73E-07 hsa-miR-625-3p0.3220.0006770.004491 hsa-miR-508-3p0.3740.0009610.005886 hsa-miR-24-3p0.3940.0000020.000040 hsa-miR-151b0.3960.0137940.057933 hsa-miR-23a-3p0.3994.53E-131.66E-11 hsa-miR-143-3p0.4050.0016450.009181 hsa-miR-181c-5p0.4110.0000090.000118 hsa-miR-130a-3p0.4473.85E-091.00E-07 hsa-miR-26a-5p0.4581.50E-104.71E-09 hsa-let-7a-5p0.4910.0000070.000100 hsa-miR-149-5p0.5320.0001440.001271Abbreviations: FC, fold change; FDR, false discovery rate; H, healthy; miRNA, microRNA; PP, psoriatic lesional. Open table in a new tab Supplementary Table S5MiRNAs Differentially Expressed in Keratinocytes from Psoriatic Lesions Versus Keratinocytes from Nonlesional Skin Not Identified in Previous Studies Showing Global miRNA Expression in Psoriatic Skin/Epidermis. Upregulated miRNAs and downregulated miRNAs in the PP vs. PN comparison, which were not identified in previous publications (Joyce et al., 2011Joyce C.E. Zhou X. Xia J. Ryan C. Thrash B. Menter A. et al.Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome.Hum Mol Genet. 2011; 20: 4025-4040Crossref PubMed Scopus (145) Google Scholar, Løvendorf et al., 2015Løvendorf M.B. Mitsui H. Zibert J.R. Røpke M.A. Hafner M. Dyring-Andersen B. et al.Laser capture microdissection followed by next-generation sequencing identifies disease-related microRNAs in psoriatic skin that reflect systemic microRNA changes in psoriasis.Exp Dermatol. 2015; 24: 187-193Crossref PubMed Scopus (32) Google Scholar, Zibert et al., 2010Zibert J.R. Løvendorf M.B. Litman T. Olsen J. Kaczkowski B. Skov L. MicroRNAs and potential target interactions in psoriasis.J Dermatol Sci. 2010; 58: 177-185Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar) as differentially expressed in psoriatic skin/epidermismiRNAFC (Lin)P-valueFDRUpregulated novel_mir_26353241.4397.349E-221.080E-19 hsa-miR-1247-5p531.9700.000010.00012 hsa-miR-125b-1-3p497.0570.000060.00083 novel_mir_2396351.3880.000020.00038 hsa-miR-4446-3p351.3540.000740.00608 hsa-miR-3166314.2230.000400.00383 novel_mir_670295.3220.003480.02226 hsa-miR-218-5p259.3280.002540.01779 novel_mir_976252.4630.001610.01167 hsa-miR-3177-3p178.5760.005160.02998 novel_mir_2458140.5410.000080.00101 hsa-miR-3620-5p114.7860.000510.00447 novel_mir_23869.8530.000660.00557 hsa-miR-106a-5p52.6030.005170.02998 hsa-miR-4800-3p52.2760.004250.02601 novel_mir_90340.7180.004880.02907 hsa-miR-185-3p22.8830.018640.08465 hsa-miR-797415.5430.000140.00158 hsa-miR-378a-5p13.9500.014880.07056 novel_mir_149611.3320.023350.09624 hsa-miR-190a-5p6.9140.022860.09624 hsa-miR-9414.0500.000010.00024 hsa-miR-4213.5560.000120.00144 hsa-miR-3614-5p3.5510.010750.05576 hsa-miR-100-5p3.4800.002140.01524 hsa-miR-4843.2080.022980.09624 hsa-miR-877-5p3.1296.209E-091.826E-07 hsa-miR-3158-3p3.0890.022060.09624 hsa-miR-128-3p3.0880.000050.00076 hsa-miR-140-3p2.3050.015350.07201 hsa-miR-36152.2200.000280.00272 hsa-miR-27b-5p2.0690.000010.00012 hsa-miR-200b-3p1.8840.000190.00208 hsa-miR-106b-5p1.8220.009420.05066 hsa-miR-92b-3p1.7930.001180.00899 hsa-miR-500a-3p1.7840.010870.05576Downregulated hsa-miR-211-5p0.4860.003320.02152 hsa-miR-181c-5p0.4760.000190.00208 hsa-miR-509-3p0.4740.002680.01844 hsa-miR-195-5p0.4540.023570.09624 hsa-miR-101-3p0.4530.000010.00012 hsa-miR-24-3p0.4490.000050.00069 hsa-miR-23a-3p0.4302.657E-118.370E-10 hsa-miR-508-3p0.3660.000740.00608 hsa-let-7c-5p0.3382.477E-118.370E-10 hsa-miR-181b-5p0.3161.651E-127.280E-11 hsa-miR-625-3p0.3090.000450.00418 hsa-miR-6510-3p0.2540.000030.00048 hsa-miR-181a-5p0.2261.247E-191.100E-17 hsa-miR-10b-5p0.2100.001570.01154 hsa-miR-150-5p0.1240.000010.00015 hsa-miR-138-1-3p0.0460.003660.02305 hsa-miR-5089-5p0.0450.002800.01870 hsa-miR-44900.0022.188E-086.032E-07Abbreviations: FC, fold change; FDR, false discovery rate; H, healthy; miRNA, microRNA; PN, psoriatic nonlesional. Open table in a new tab Supplementary Table S6Differentially Expressed Novel miRNAs in Psoriatic KeratinocytesNovel miRNASequenceChromosomeAnalysis groupnovel-miR-2635CCGCUGUGAUGUUAUCUGAGGchr7PP vs H; PP vs PNnovel-miR-1496CAAAAUGAUGAGGUACCUGAUAchr20PP vs H; PP vs PN; PN vs Hnovel-miR-2396UCACUGGGAGGCAUCUGGAGCUGAchr17PP vs H; PP vs PNnovel-miR-2458AAAUGAGUCUGUAGAGGAGCCUchr1PP vs H; PP vs PNnovel-miR-1748AAGGAGAGAGAACAGGCUGAGGUchr22PP vs Hnovel-miR-1406AGCACUGAUGAGAAAACUGAGCchr16PP vs Hnovel-miR-903AGUGGGUGAUGUUUGCUGACACUchr22PP vs H; PP vs PNnovel-miR-238AGCCCAGGAUGAAACUCUGACAchr4PP vs H; PP vs PNnovel-miR-20ACAGAGCAGCUGUUGGAUCCchr14PP vs H; PN vs Hnovel-miR-976CUGCUCUGAUGUCUGGCUGAGCchr14PP vs PNnovel-miR-670AUAGAUGAGGGCUUGGCUGUGAchr1PP vs PNAbbreviations: chr, chromosome; H, healthy; miRNA, microRNA; PN, psoriatic nonlesional; PP, psoriatic lesional.Eleven novel miRNAs were differentially expressed (Fold change > 1.4, FDR < 0.1) in one or more group comparisons (PP vs. H, PP vs. PN, and PN vs. H). Open table in a new tab Supplementary Table S7Differentially Expressed MiRNA Genes That Overlap (±500 Kilobases) With Genomic Loci That Achieve Genome-Wide Significance in Previous Psoriasis Genome-Wide Association StudiesmiRNAChromosome<Start<EndStrandSNPPositionNearby genesReferencesPP vs H hsa-miR-146a-5pchr5159912379159912400+rs2431697159879978PTTG1Stuart et al., 2015Stuart P.E. Nair R.P. Tsoi L.C. Tejasvi T. Das S. Kang H.M. et al.Genome-wide Association Analysis of Psoriatic Arthritis and Cutaneous Psoriasis Reveals Differences in Their Genetic Architecture.Am J Hum Genet. 2015; 97: 816-836Abstract Full Text Full Text PDF PubMed Google Scholar (PMID ) hsa-miR-141-5pchr1270732767073297+rs7587396626369NCAPD2Stuart et al., 2015Stuart P.E. Nair R.P. Tsoi L.C. Tejasvi T. Das S. Kang H.M. et al.Genome-wide Association Analysis of Psoriatic Arthritis and Cutaneous Psoriasis Reveals Differences in Their Genetic Architecture.Am J Hum Genet. 2015; 97: 816-836Abstract Full Text Full Text PDF PubMed Google Scholar (PMID )PP vs PN hsa-miR-944chr3189547764189547785+rs28512356189615475TP63Stuart et al., 2015Stuart P.E. Nair R.P. Tsoi L.C. Tejasvi T. Das S. Kang H.M. et al.Genome-wide Association Analysis of Psoriatic Arthritis and Cutaneous Psoriasis Reveals Differences in Their Genetic Architecture.Am J Hum Genet. 2015; 97: 816-836Abstract Full Text Full Text PDF PubMed Google Scholar (PMID ) hsa-miR-146a-5pchr5159912379159912400+rs2431697159879978PTTG1Stuart et al., 2015Stuart P.E. Nair R.P. Tsoi L.C. Tejasvi T. Das S. Kang H.M. et al.Genome-wide Association Analysis of Psoriatic Arthritis and Cutaneous Psoriasis Reveals Differences in Their Genetic Architecture.Am J Hum Genet. 2015; 97: 816-836Abstract Full Text Full Text PDF PubMed Google Scholar (PMID ) hsa-miR-141-5pchr1270732767073297+rs7587396626369NCAPD2Stuart et al., 2015Stuart P.E. Nair R.P. Tsoi L.C. Tejasvi T. Das S. Kang H.M. et al.Genome-wide Association Analysis of Psoriatic Arthritis and Cutaneous Psoriasis Reveals Differences in Their Genetic Architecture.Am J Hum Genet. 2015; 97: 816-836Abstract Full Text Full Text PDF PubMed Google Scholar (PMID ) hsa-miR-211-5pchr153135729831357319-rs2862457831637666KLF13Tsoi et al., 2017Tsoi L.C. Stuart P.E. Tian C. Gudjonsson J.E. Das S. Zawistowski M. et al.Large scale meta-analysis characterizes genetic architecture for common psoriasis associated variants.Nat Commun. 2017; 8: 15382Crossref PubMed Scopus (60) Google Scholar (PMID )Abbreviations: chr, chromosome; H, healthy; miRNA, microRNA; PN, psoriatic nonlesional; PP, psoriatic lesional; SNP, single nucleotide polymorphism. Open table in a new tab Abbreviations: FC, fold change; FDR, false discovery rate; miRNA, microRNA. Abbreviations: FC, fold change; FDR, false discovery rate; miRNA, microRNA. Abbreviations: FC, fold change; FDR, false discovery rate; miRNA, microRNA; PN, psoriatic nonlesional; H, healthy. Abbreviations: FC, fold change; FDR, false discovery rate; H, healthy; miRNA, microRNA; PP, psoriatic lesional. Abbreviations: FC, fold change; FDR, false discovery rate; H, healthy; miRNA, microRNA; PN, psoriatic nonlesional. Abbreviations: chr, chromosome; H, healthy; miRNA, microRNA; PN, psoriatic nonlesional; PP, psoriatic lesional. Eleven novel miRNAs were differentially expressed (Fold change > 1.4, FDR < 0.1) in one or more group comparisons (PP vs. H, PP vs. PN, and PN vs. H). Abbreviations: chr, chromosome; H, healthy; miRNA, microRNA; PN, psoriatic nonlesional; PP, psoriatic lesional; SNP, single nucleotide polymorphism.