NEAT1 promotes retinoblastoma progression via modulating miR-124.

Lufei Wang,Hui Zhang,Defeng Yang,Rui Tian

doi:10.1002/jcb.28825

Abstract

The long noncoding RNA nuclear‐enriched abundant transcript 1 (NEAT1) is reportedly involved in the initiation and progression of cancers of several types. However, the role, expression status, and the detailed mechanism of NEAT1 in retinoblastoma (RB) yet need to be unraveled. We explored the role and the mechanism of NEAT1 activity in RB. Our data show enhanced NEAT1 expression in RB‐affected tissues compared with the corresponding control. Functional experiments reveal that a NEAT1 knockdown in RB cells significantly inhibits proliferation, cycle progression, and facilitates apoptosis and caspase‐3 and ‐9 activities. Besides that, miR‐124 was predicted to be a target of NEAT1 and its reduced expression, as well as the inverse correlation of NEAT1 with miR‐124, was observed in RB‐affected tissues. Further, luciferase and RNA immunoprecipitation (RIP) assays confirmed the interaction between NEAT1 and miR‐124. Rescue experiments confirmed that the inhibition of miR‐124 could reverse the effect of NEAT1 on RB cell proliferation, cycle arrest, apoptosis, and caspase‐3 and ‐9 activities. Thus, NEAT1 promotes RB progression by sponging miR‐124, providing a therapeutic target for RB.

Highlights

One of the primary ocular tumors that is malignant is retinoblastoma, which affects the developing retina and is set off by mutations in the retinoblastoma (RB1) gene, usually occurring during childhood[1,2] It is well known that tumorigenesis of several cancers including RB happens due to oncogene hyperactivation and tumor‐suppressor gene inactivation.[3]
Y79 cells were transfected for 48 hours with 50 μM of siRNA or 100 nM miR‐124 mimic or inhibitor along with Lipofectamine 2000 (Invitrogen), and the efficiency of transfection was evaluated by quantitative real‐time polymerase chain reaction
When the nuclear‐enriched abundant transcript 1 (NEAT1) expression levels in 32 RB‐affected tissues and eight normal retina tissues were assessed by qRT‐polymerase chain reaction (PCR), the results show that the RB tissues have significantly higher NEAT1 expression than that in normal retinal tissues (Figure 1A)

Summary

| INTRODUCTION

One of the primary ocular tumors that is malignant is retinoblastoma, which affects the developing retina and is set off by mutations in the retinoblastoma (RB1) gene, usually occurring during childhood[1,2] It is well known that tumorigenesis of several cancers including RB happens due to oncogene hyperactivation and tumor‐suppressor gene inactivation.[3]. A class of RNAs, the long noncoding RNAs (lncRNAs), have lengths bigger than 200 nucleotides, having no protein‐encoding ability,[4] and have been reported to be involved in numerous biological activities, like cell multiplication, cell apoptosis, cycle arrest, and invasion.[5] Concurrently, lncRNAs play act as regulators in the occurrence and progress of cancers, and function either as an oncogene or as a tumor‐suppressor gene by regulating tumor‐related genes or pathways.[6,7] Till date, several cancer‐related lncRNAs have been implicated in RB progression, and act as diagnostic markers and therapeutic target for RB.[8,9,10]. This study aims to enhance the knowledge base to discern the RB progression and its mechanism

| MATERIALS AND METHODS

F: AAGGTGAAGGTCGGAGTCAA R

| RESULTS

| DISCUSSION

Findings

CONFLICT OF INTERESTS