Abstract

Naegleria species are the ubiquitous free-living amoebas that are found worldwide in soil and water. Among Naegleria spp., N. fowleri can cause primary amebic meningoencephalitis (PAM). Ninety water samples were collected from the pond of parks. Also, the water quality parameters were measured at the sampling site (such as temperature, pH, total dissolved solids (TDS), electrical conductivity (EC) and Turbidity).After filtering, the samples were cultured on Bacto-agar enriched with Escherichia coli. A PCR assay was conducted on the culture-positive samples in the ITS1, 5.8SrDNA and ITS2 regions, and then the PCR products were sequenced.The pond water of parks was contaminated with some Naegleria spp. (except N. fowleri) and a Vahlkampfia avara. There was no significant relationship between water quality parameters and the presence of Naegleria (p?>?0.05).Our protocol investigates to detect Naegleria spp. from ponds water of parks in Mashhad city and the relations between the water quality parameters and its presence.

Highlights

  • Naegleria species are the ubiquitous free-living amoebas that are found worldwide in soil and water

  • A PCR assay was conducted on the culture-positive samples in the ITS1, 5.8SrDNA and ITS2 regions, and the PCR products were sequenced

  • ARTICLE INFO Protocol name: Naegleria species population found in pond water of parks in Mashhad city, Can the physicochemical factors affect it? Keywords: Naegleria, Pond water, Physicochemical factors Article history: Received 25 August 2018; Accepted 6 October 2018; Available online 24 October 2018

Read more

Summary

Protocol Article

Naegleria species population found in pond water of parks in Mashhad city, Can the physicochemical factors affect it?.

Specifications Table
Sample collection
GTGAAAACCTTTTTTCCATTTACA GAACCTGCGTAGGGATCATTT
Isolation Naegleria from water samples
Findings
DNA extraction and PCR
Full Text
Paper version not known

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call

Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.