Myxobolus notropis from emerald shiner, Notropis atherinoides Rafinesque, in Lake Superior

Abstract

Keywords: emerald shiner, Lake Superior, Myxobo-lus notropis, Myxozoa.The Wisconsin Department of Natural Resources(WDNR) has surveyed the emerald shiner, Notropisatherinoides Rafinesque, population in the St. LouisRiverestuary,LakeSuperiorbasinsince1981.InJuly2007, fish with haemorrhagic skin lesions andswollen abdomens were observed for the first time(Fig. 1a). Internal examination revealed a systemicinfection of a myxosporean parasite, with a largenumber of spores in mesenteric fat and peritonealfluid (Fig. 1b). The parasite was identified as Myxo-bolus notropis Fantham, Porter & Richardson, 1939based on spore morphology and site of infection;previous records are from common shiner, Notropiscornutus Mitchill, and blacknose shiner, Notropisheterolepis Eigenmann & Eigenmann.Emerald shiners were seined from Allouez Bay,an embayment of the St. Louis River, a tributary toLake Superior (92 0¢6.6¢¢W, 46 41¢54.3¢¢N). Nine-teen fish were netted on June 11, 2008 and 10 onAugust 7, 2008. Fish were killed by overdose oftricaine methane sulphonate (MS-222) and sentovernight on ice to Oregon State University (OSU)where they were dissected. Parasite spores wereimaged digitally using a Leica DMLM microscopewith bright field and Nomarski interferencecontrast at ·400 and ·1000 magnifications, andmeasured later from these images.Peritoneal fluid was sampled from the two fishmost heavily infected with M. notropis and sporeabundance was estimated using a haemocytometer.Only one type of myxospore was observed in thesetwo fish. Total DNA was extracted from theperitoneal fluid using a DNeasy Blood & TissueKit following the manufacturers instructions(QIAGEN). The 18S small subunit ribosomalRNA (ssrRNA) gene was amplified by PCR: a1040 nt 5¢ fragment with universal primer ERIB1(ACCTGGTTGATCCTGCCAG; Barta, Martin,Liberator, Dashkevicz, Anderson, Feighner, Elbr-echt, Perkins-Barrow, Jenkins, Danforth, Ruff P Hallett & Diamant 2001) and an overlapping1250 nt 3¢ fragment with Myxgen4F (GTGCCTTGAATAAATCAGAG; Diamant, Whipps K Barta et al. 1997). PCR chemistryand cycling conditions have been publishedpreviously (Atkinson & Bartholomew 2009).Amplification was verified by visualization ofappropriately sized bands after electrophoresis inan agarose gel.Amplicons were purified directly from PCRproducts using a PCR Purification Kit followingthe manufacturers instructions (Qiagen). PurifiedDNA was quantified using a spectrophotometer(NanoDrop Technologies). Sequencing reactions