Myogenic Stage, Sarcomere Length, and Protease Activity Modulate Localization of Muscle-specific Calpain

Siegfried Labeit,Katsuhide Yoshioka,Yasuko Ono,Koichi Ojima,Yukiko Kawabata,Hiroyuki Sorimachi,Naoko Doi

doi:10.1074/jbc.m610806200

Abstract

p94/calpain 3 is a Ca(2+)-binding intracellular protease predominantly expressed in skeletal muscles. p94 binds to the N2A and M-line regions of connectin/titin and localizes in the Z-bands. Genetic evidence showing that compromised p94 proteolytic activity leads to muscular dystrophy (limb-girdle muscular dystrophy type 2A) indicates the importance of p94 function in myofibrils. Here we show that a series of p94 splice variants is expressed immediately after muscle differentiation and differentially change localization during myofibrillogenesis. We found that the endogenous N-terminal (but not C-terminal) domain of p94 was not only localized in the Z-bands but also directly bound to sarcomeric alpha-actinin. These data suggest the incorporation of proteolytic N-terminal fragments of p94 into the Z-bands. In myofibrils localization of exogenously expressed p94 shifted from the M-line to N2A as the sarcomere lengthens beyond approximately 2.6 and 2.8 microm for wild-type and proteaseinactive p94, respectively. These data demonstrate for the first time that p94 proteolytic activity is involved in responses to muscle conditions, which may explain why p94 inactivation causes limb-girdle muscular dystrophy.

Highlights

Protease-inactive form of p94, p94:C129S, and p94 gene knockout caused a mild myopathy and muscular dystrophy, respectively [5,6,7]
A defect in the proper proteolytic activity of p94 is a common feature of limb-girdle muscular dystrophy type 2A pathogenic mutations [8]
One of the earliest myofibrillar proteins expressed in vertebrate myogenic cells is connectin/titin [9], which is the largest protein molecule known and is abundantly expressed in striated muscles where it constitutes an intrasarcomeric filament [10, 11]

Summary

Protease Activity Changes Localization of Muscle Calpain

P94 Exon 1–Exon 24 p94 Exon 4–Exon 9 p94 Exon 4–Exon 17 p94 Exon 10–Exon 17 Connectin/ titin N2A Connectin/ titin M9M10 ␮-Calpain atcgagctcggatccATGCCAACTGTTATTAGTa AACCACCGCAATGAGTTCTGG AACCACCGCAATGAGTTCTGG ATAAGCTTCAGACCTGGACG AAGGTACCAACCACTGCCACGTTTATTGCAA CGTGTACACTCTTGAAATCC GAATTGGAATACCACATTTTACGAGG. Regions in sarcomeres, suggesting that p94 may contribute to myofibril organization in cooperation with other connectin ligands and/or connectin. This study aims 1) to characterize the spatiotemporal expression and localization of p94 and its splicing variants during skeletal muscle differentiation in relation to connectin, 2) to identify p94 interacting molecules in the Z-band components, and 3) to clarify the role of the proteolytic activity of p94 in the unique context of muscle cells. Detailed immunohistochemical study using primary cultures of skeletal muscle cells revealed that p94 and its splice variants differ in their expression and localization during maturation of sarcomere structures. It was demonstrated that correlation between localization of p94 and sarcomere lengths exists, which at least in part involves its protease activity

EXPERIMENTAL PROCEDURES

Cytosolic but Not Sarcomeric

Findings

DISCUSSION