Abstract

BackgroundMycobacterium abscessus group includes antibiotic-resistant, opportunistic mycobacteria that are responsible for sporadic cases and outbreaks of cutaneous, pulmonary and disseminated infections. However, because of their close genetic relationships, accurate discrimination between the various strains of these mycobacteria remains difficult. In this report, we describe the development of a multispacer sequence typing (MST) analysis for the simultaneous identification and typing of M. abscessus mycobacteria. We also compared MST with the reference multilocus sequence analysis (MLSA) typing method.ResultsBased on the M. abscessus CIP104536T genome, eight intergenic spacers were selected, PCR amplified and sequenced in 21 M. abscessus isolates and analysed in 48 available M. abscessus genomes. MST and MLSA grouped 37 M. abscessus organisms into 12 and nine types, respectively; four formerly “M. bolletii” organisms and M. abscessus M139 into three and four types, respectively; and 27 formerly “M. massiliense” organisms grouped into nine and five types, respectively. The Hunter-Gaston index was off 0.912 for MST and of 0.903 for MLSA. The MST-derived tree was similar to that based on MLSA and rpoB gene sequencing and yielded three main clusters comprising each the type strain of the respective M. abscessus sub-species. Two isolates exhibited discordant MLSA- and rpoB gene sequence-derived position, one isolate exhibited discordant MST- and rpoB gene sequence-derived position and one isolate exhibited discordant MST- and MLSA-derived position. MST spacer n°2 sequencing alone allowed for the accurate identification of the different isolates at the sub-species level.ConclusionsMST is a new sequencing-based approach for both identifying and genotyping M. abscessus mycobacteria that clearly differentiates formerly “M. massiliense” organisms from other M. abscessus subsp. bolletii organisms.

Highlights

  • Mycobacterium abscessus group includes antibiotic-resistant, opportunistic mycobacteria that are responsible for sporadic cases and outbreaks of cutaneous, pulmonary and disseminated infections

  • Mycobacterium abscessus mycobacteria are increasingly being cultured from respiratory tract specimens collected from patients with chronic pulmonary diseases, including cystic fibrosis [1,2,3,4,5,6,7,8,9]

  • Confusing results based on rpoB sequencing have been reported [21], and combining sequencing of the rpoB, hsp65 and secA genes has been advocated for the optimal identification of the M. abscessus mycobacteria [25]

Read more

Summary

Conclusions

MST is a new sequencing-based approach for both identifying and genotyping M. abscessus mycobacteria that clearly differentiates formerly “M. massiliense” organisms from other M. abscessus subsp. bolletii organisms.

Background
Methods
F: AGCCAACTGCCATGGCGCTT 495
Conclusion

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call

Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.