Abstract
The coxsackievirus 2B protein is a small hydrophobic protein (99 amino acids) that increases host cell membrane permeability, possibly by forming homo-multimers that build membrane-integral pores. Previously, we defined the functional role of the two hydrophobic regions HR1 and HR2. Here, we investigated the importance of regions outside HR1 and HR2 for multimerization, increasing membrane permeability, subcellular localization, and virus replication through analysis of linker insertion and substitution mutants. From these studies, the following conclusions could be drawn. (i) The hydrophilic region ((58)RNHDD(62)) between HR1 and HR2 is critical for multimerization and increasing membrane permeability. Substitution analysis of Asn(61) and Asn(62) demonstrated the preference for short polar side chains (Asp, Asn), residues that are often present in turns, over long polar side chains (Glu, Gln). This finding supports the idea that the hydrophilic region is involved in pore formation by facilitating a turn between HR1 and HR2 to reverse chain direction. (ii) Studies undertaken to define the downstream boundary of HR2 demonstrated that the aromatic residues Trp(80) and Trp(82), but not the positively charged residues Arg(81), Lys(84), and Lys(86) are important for increasing membrane permeability. (iii) The N terminus is not required for multimerization but does contribute to the membrane-active character of 2B. (iv) The subcellular localization of 2B does not rely on regions outside HR1 and HR2 and does not require multimerization. (v) Virus replication requires both the membrane-active character and an additional function of 2B that is not connected to this activity.
Highlights
The coxsackievirus 2B protein is a small hydrophobic protein (99 amino acids) that increases host cell membrane permeability, possibly by forming homo-multimers that build membrane-integral pores
This finding supports the idea that the hydrophilic region is involved in pore formation by facilitating a turn between HR1 and HR2 to reverse chain direction. (ii) Studies undertaken to define the downstream boundary of HR2 demonstrated that the aromatic residues Trp80 and Trp82, but not the positively charged residues Arg81, Lys84, and Lys86 are important for increasing membrane permeability. (iii) The N terminus is not required for multimerization but does contribute to the membraneactive character of 2B. (iv) The subcellular localization of 2B does not rely on regions outside HR1 and HR2 and does not require multimerization. (v) Virus replication requires both the membrane-active character and an additional function of 2B that is not connected to this activity
Identification of Functional Regions in the 2B Protein—Previously, we demonstrated that both HR1 and HR2 are important determinants for multimerization and increasing membrane permeability [4, 15, 27]
Summary
5Ј-ggcagtcacagtgatgagtgctgcgtggttcctcaccac 5Ј-agtcacagtgatcagcaccacgtggttcctcaccac 5Ј-ggcagtcacagtgatcaggttattgtggtttcgaaccacaattactaaggctga 5Ј-ggcagtcacagtgatgagctcttcgtggttcctcaccac 5Ј-ggcagtcacagtgatcagctgatggtggttcctcaccacaat 5Ј-agtcacagtgatcagatctgcgtggttcctcaccac 5Ј-agtcacagtgatcaggtcgacgtggttcctcaccacaat 5Ј-agtcacagtgatcaggtcgttgtggttcctcaccacaat 5Ј-agtgatcaggtcttcgtggttcct 5Ј-agtcacagtgatcaggtcctggtggttcctcaccac 5Ј-agtcacagtgatcagggcgtcgtggttcctcaccac 5Ј-agtcacagtgatcaggacgtcgtggttcctcaccac 5Ј-ggcagtcacagtgatcaggttatcgtggtttcgaaccacaattactaaggctga 5Ј-agtcacagtgatgagctcatcgtggtt 5Ј-ggcagtcacagtgatcagctgatcgtggttcctcaccac 5Ј-tgacaccttctgtttgagcgctcgagccggggacgaggtacaacc 5Ј-tgacaccttctgtttgagataccggtacggggacgaggtacaacc 5Ј-ctgtttgagccaccgcgccggcgacgaggtacaaccgat 5Ј-caccttctgtttgagggcccgccacggggacga 5Ј-gtaatattgtgacaccgcctgtgcgagccaggcccacggggacgaggt 5Ј-cttctgtttgagcacggcccacggggacgaggt 5Ј-ttgtgacaccttctgcgcaagccaccgccacgggga 5Ј-gtaatattgtgacacggcctgtttgagccaccg crease in plasma membrane permeability, suggesting that these two phenomena are coupled [56]. Mutations in 2B that affect its ability to increase membrane permeability interfere with an early step in viral RNA replication [15]. Virus replication is affected by mutations in 2B that do not affect its ability to increase membrane permeability [15], arguing for an additional role of 2B in RNA replication. Mutations in each of the hydrophobic regions interfere with the ability of the 2B protein to homo-multimerize and to increase membrane permeability [15, 27, 30]. We describe the effects of linker insertion and substitution mutations in different regions of the 2B protein on homo-multimerization, increasing membrane permeability, subcellular localization, and virus replication
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
