Mutation at Different Sites of Metal Transporter Gene OsNramp5 Affects Cd Accumulation and Related Agronomic Traits in Rice (Oryza sativa L.).

Tiankang Wang,Shufeng Song,Hongjun Xie,Mudan Qiu,Yuefeng Fu,Yan Tian,Chengxia Li,Yixing Li,Jiong Wen,Ge Chen,Jianlong Wang,Muwen Chen,Li Li,Dingyang Yuan

doi:10.3389/fpls.2019.01081

Abstract

OsNramp5 is a key gene involved in the control of the uptake of Cd, Mn, and other metal ions by rice root cells. The functional deficiency of this gene can significantly reduce the accumulation of Cd in rice grains, but the effects of its mutation on agronomic traits such as yield and quality have not been investigated comprehensively yet. In the present study, three Huanghuazhan-based OsNramp5 mutants [LCH1 (Low Cadmium Huanghuazhan 1), LCH2 (Low Cadmium Huanghuazhan 2), and LCH3 (Low Cadmium Huanghuazhan 3)] were obtained using clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9 (CRISPR/Cas9) technology. The mutation-type analysis showed that LCH1, LCH2, and LCH3 encoded defective OsNramp5 protein sequences containing only 76aa, 176aa, and 266aa, respectively. The determination of metal content and the statistics of related agronomic traits revealed that the functionally deficient OsNramp5 not only significantly reduced the accumulation of Cd in the grains of the mutants but also affected rice yield and quality. However, with the decrease of OsNramp5 mutation degree, its effects on chlorenchyma Mn accumulation, yield, and quality were also diminished. Additionally, we also found that the increase in the concentration of Mn in the soil restored the phenotype of the declined yield and quality due to the functional deficiency of OsNramp5. Our findings provide novel insights into and new materials for breeding rice varieties with low Cd accumulation and excellent agronomic traits under severe Cd pollution environment.

Highlights

Rice is one of the most important food crops in the world
target site 1 (TS1) is located at the second exon (396–415 bp), with a sequence of TTCCTTGCCCATGTTGGTCC; target site 2 (TS2) is located at the sixth exon 2,264–2,283 bp, that is, the front part of the natural resistance-associated macrophage protein (Nramp) domain, with a sequence of GCACTCTACTGCTTCTTGGC; and target site 3 (TS3) is located at the ninth exon (3,184–3,203 bp), that is, the middle part of the Nramp domain, with a sequence of GTACGAGAGCGGGTTCGCGC
OsNramp5 is a key gene for controlling the uptake of Cd, Mn, and other metal ions by rice root cells

Summary

Introduction

Rice is one of the most important food crops in the world. The following four methods are mainly used to reduce the Cd content in rice grains. The third is screening out low-Cd-accumulating cultivars from existing rice varieties (Zhang Y et al, 2017; Tang et al, 2018). The fourth is to reduce the content of Cd in the soil through phytoremediation (Shao et al, 2017; Acosta et al, 2018). These four approaches have considerable limitations in practice. With the rapid development of molecular biology, the major gene OsNramp, involved in Cd uptake in rice, has been cloned, which enables a significant reduction in rice Cd accumulation through more economical, rapid, and efficient methods (Ishikawa et al, 2012)

Methods

Results

Conclusion