Multifunctional receptor-targeted nanocomplexes for the delivery of therapeutic nucleic acids to the Brain

Gavin D Kenny,Alison S Bienemann,Aristides D Tagalakis,John A Pugh,Katharina Welser,Frederick Campbell,Alethea B Tabor,Helen C Hailes,Steven S Gill,Mark F Lythgoe,Cameron W Mcleod,Edward A White,Stephen L Hart

doi:10.1016/j.biomaterials.2013.07.081

Gavin D Kenny, Alison S Bienemann + Show 11 more

Open Access

https://doi.org/10.1016/j.biomaterials.2013.07.081

Copy DOI

Abstract

Convection enhanced delivery (CED) is a method of direct injection to the brain that can achieve widespread dispersal of therapeutics, including gene therapies, from a single dose. Non-viral, nanocomplexes are of interest as vectors for gene therapy in the brain, but it is essential that administration should achieve maximal dispersal to minimise the number of injections required. We hypothesised that anionic nanocomplexes administered by CED should disperse more widely in rat brains than cationics of similar size, which bind electrostatically to cell-surface anionic moieties such as proteoglycans, limiting their spread. Anionic, receptor-targeted nanocomplexes (RTN) containing a neurotensin-targeting peptide were prepared with plasmid DNA and compared with cationic RTNs for dispersal and transfection efficiency. Both RTNs were labelled with gadolinium for localisation in the brain by MRI and in brain sections by LA-ICP-MS, as well as with rhodamine fluorophore for detection by fluorescence microscopy. MRI distribution studies confirmed that the anionic RTNs dispersed more widely than cationic RTNs, particularly in the corpus callosum. Gene expression levels from anionic formulations were similar to those of cationic RTNs. Thus, anionic RTN formulations can achieve both widespread dispersal and effective gene expression in brains after administration of a single dose by CED.

Highlights

Genetic therapies involve the enhancement, replacement, modification, regulation and silencing of gene expression and offer great promise for the treatment of a wide range of diseases, of the central nervous system (CNS), including neurodegenerative, neuromuscular and metabolic diseases as well as cancers, many of which are currently untreatable [1e5]
The oligonucleotide primers and standards for qRT-PCR were provided by qStandard (Middlesex, UK) and were as follows: eGFP: forward primer 50-CTTCAAGATCCGC CACAACAT-30 and reverse primer 50-GGTGCTCAGGTAGTGGTTGTC-30; Ribosomal protein L13 (Rpl13): forward primer 50-CCCTACAGTTAGATACCACACCAA-30 and reverse primer 50-GATACCAGCCACCCTGAGC-30; Beta actin: forward primer 50- ACGGTCAGGTCATCACTATCG30 and reverse primer 50-AGCCACCAATCCACACAGA-30; Sdha: forward primer 50TGGACCTTGTCGTCTTTGG-30 and reverse primer 50-TTTGCCTTAATCGGAGGAAC-30
Targeted anionic and cationic formulations both contained a peptide with a cationic oligolysine domain for efficient packaging of plasmid DNA and a neurotensin (Nt) receptor binding domain for cell targeting

Summary

Introduction

Genetic therapies involve the enhancement, replacement, modification, regulation and silencing of gene expression and offer great promise for the treatment of a wide range of diseases, of the central nervous system (CNS), including neurodegenerative, neuromuscular and metabolic diseases as well as cancers, many of which are currently untreatable [1e5]. Systemic delivery is limited in efficacy by the almost impermeable nature of the blood brain barrier (BBB) and rapid clearance of nanocomplexes from the circulation by the reticuloendothelial system (RES), in the liver [8e10]. Direct injection methods such as intraparenchymal, intracerebroventricular and intrathecal injection, depend on diffusion for drug dispersal and so are limited in their dispersal by drug concentration and require injections at multiple sites to achieve widespread coverage of the brain

Methods

Results

Conclusion