MouSensor: A Versatile Genetic Platform to Create Super Sniffer Mice for Studying Human Odor Coding

Charlotte D’Hulst,Raena B Mina,Zachary Gershon,Sophie Jamet,Antonio Cerullo,Delia Tomoiaga,Li Bai,Leonardo Belluscio,Matthew E Rogers,Yevgeniy Sirotin,Paul Feinstein

doi:10.1016/j.celrep.2016.06.047

Abstract

Typically, ∼0.1% of the total number of olfactory sensory neurons (OSNs) in the main olfactory epithelium express the same odorant receptor (OR) in a singular fashion and their axons coalesce into homotypic glomeruli in the olfactory bulb. Here, we have dramatically increased the total number of OSNs expressing specific cloned OR coding sequences by multimerizing a 21-bp sequence encompassing the predicted homeodomain binding site sequence, TAATGA, known to be essential in OR gene choice.Singular gene choice is maintained in these "MouSensors." Invivo synaptopHluorin imaging of odor-induced responses by known M71 ligands shows functional glomerular activation in an M71 MouSensor. Moreover, a behavioral avoidance task demonstrates that specific odor detection thresholds are significantly decreased in multiple transgenic lines, expressing mouse or human ORs. We have developed a versatile platform to study gene choice and axon identity, to create biosensors with great translational potential, and to finally decode human olfaction.

Highlights

Odorant receptor (OR) genes form the largest multigene family in mammals, with about 1,200 members in the mouse and 350 in humans (Zhang and Firestein, 2002)
Because analysis of chimeric P/P3 promoter transgenes suggested that DNA spacing of the HD might influence OR gene choice, we designed a gene choice enhancer consisting of various multimers of a 21-bp sequence from the H element (ACATAACTTTTTAATGAGTCT), each covering two DNA turns of 10.5 bp and thereby allowing for maximum cooperativity of transcription factors, resulting in a radical increase in expression of any cloned OR coding sequence (CDS), which was never obtained with the 9x19 transgenic approach
We provide a genetic platform, which increases the total population of olfactory sensory neurons (OSNs) expressing a specific OR, enabling us to robustly study OR gene choice, axon identity, and odor coding simultaneously in its intact in vivo environment

Summary

Graphical Abstract

D’Hulst et al have increased the total number of neurons expressing specific mouse or human odorant receptors (ORs) in the nose of a mouse by genetically controlling OR gene choice. These MouSensors show lower specific odor detection thresholds and provide a platform to study OR gene expression and odor coding in vivo. D’Hulst et al, 2016, Cell Reports 16, 1115–1125 July 26, 2016 a 2016 The Authors.

SUMMARY

INTRODUCTION

RESULTS

Conclusions

EXPERIMENTAL PROCEDURES