Mouse cell line authentication

Jamie L Almeida,Kenneth D Cole,Carolyn R Hill

doi:10.1007/s10616-013-9545-7

Jamie L Almeida, Kenneth D Cole + Show 1 more

Open Access

https://doi.org/10.1007/s10616-013-9545-7

Copy DOI

Abstract

The scientific community has responded to the misidentification of human cell lines with validated methods to authenticate these cells; however, few assays are available for nonhuman cell line identification. We have developed a multiplex polymerase chain reaction assay that targets nine tetranucleotide short tandem repeat (STR) markers in the mouse genome. Unique profiles were obtained from seventy-two mouse samples that were used to determine the allele distribution for each STR marker. Correlations between allele fragment length and repeat number were determined with DNA Sanger sequencing. Genotypes for L929 and NIH3T3 cell lines were shown to be stable with increasing passage numbers as there were no significant differences in fragment length with samples of low passage when compared to high passage samples. In order to detect cell line contaminants, primers for two human STR markers were incorporated into the multiplex assay to facilitate detection of human and African green monkey DNA. This multiplex assay is the first of its kind to provide a unique STR profile for each individual mouse sample and can be used to authenticate mouse cell lines.

Highlights

We have developed a multiplex polymerase chain reaction assay that targets nine tetranucleotide short tandem repeat (STR) markers in the mouse genome
An updated list of misidentified human cell lines compiled by Capes-Davis and Freshney can be found on the American Type Culture Collection (ATCC) website: http://standards.atcc.org/kwspub/ home/the_international_cell_line_authentication_com mittee-iclac_/Database_of_Cross_Contaminated_or_Misidentified_Cell_Lines.pdf
Reports have been published of multiplexing mouse SSLPs post-PCR by pooling the amplified products to distinguish between different strains of inbred mice (Witmer et al 2003); most of the microsatellite markers that have been used for these purposes are dinucleotide in nature (Dietrich et al 1996), mainly CA repeats, which result in noisy stutter

Summary

Introduction

There are methods in place for authenticating human cell lines using multiplex PCR assays that target short tandem repeat (STR) markers in the human genome and are capable of generating a unique individual genotypic profile (Stacey et al 1992; Masters 2001). Reports have been published of multiplexing mouse SSLPs post-PCR by pooling the amplified products to distinguish between different strains of inbred mice (Witmer et al 2003); most of the microsatellite markers that have been used for these purposes are dinucleotide in nature (Dietrich et al 1996), mainly CA repeats, which result in noisy stutter. This report describes an assay that can be used to authenticate mouse cell lines resulting in unique profiles for individual mouse samples based on tetranucleotide repeats that are stable with high passage number in the two different cell lines tested

Materials and methods

X-1 R:GAAGGTATATATCAAGATGGCATTATCA

Results and discussion

Evaluation of STR markers