Molecular typing of Treponema pallidum: identification of a new sequence of tp0548 gene in Shandong, China.

Abstract

To the Editor We read with interest the report by Dai et al.1 showing that they found a new tp0548 sequence named“j.” In our latest study, we also found a new sequence of tp0548 gene, which is different from their finding, and named it as type “k.” Since 1998, molecular characterization of Treponema pallidum has entailed analysis of 2 genes (arp, tpr) to type (CDC subtype). In 2010, Marra et al.2 developed an enhanced strain typing method, adding tp0548 gene sequence types to the existing CDC genotype system. The method is based on (1) determination of the number of 60-base-pair (bp) repeats in the acidic repeat protein (arp) gene, (2) restriction fragment length polymorphism analysis of T. pallidum repeat (tpr) subfamily II genes, and (3) sequence analysis of an 84-bp region of tp0548. Previous work showed that 10 types (a–j) were identified for tp0548 gene. We performed this study to determine the diversity of T. pallidum strains circulating in Shandong. The study was approved by the human medical and ethics committee of Shandong Provincial Hospital for Skin Diseases. T. pallidum isolates were derived from primary and secondary anogenital lesions of patients with syphilis presenting at Shandong Provincial Hospital for Skin Diseases between 2010 and 2012. Sufficient DNA for full molecular typing existed in 48 of 67 samples. Arp and tpr genes were amplified based on previously described methods.3 The tp0548 genes were amplified, and the primers and cycling conditions used were those described by Marra et al.2 Sequencing of the tp0548 gene 131 bp downstream from the start codon was performed using the ABI Prism 3130xl DNA analyzer. The different sequence groups were compared to the published data.1,2 A total of 6 arp types (5, 10, 12, 14, 15, and 18 repeats) and 7 tpr types (b, d, e, i, j, k, and p) were identified. For the sequence analysis of the tp0548 gene, types c and f were identified. According to the detected sequences, we found a new sequence of the tp0548 gene (CAGGCGGCAGTGGCCACAGCCACTGGAGGGTCCAGTGGTTGCAGCGATAATGGCAACCACCCCGGCAAGGAACAGTTTCTCCAGTT), which had never been reported before, and named it as type “k.”. In total, we found 18 strain subtypes of T. pallidum. Most strains (19/48; 39.6%) belonged to subtype 14d/f, which is in keeping with data from other areas in China.4 The second most common subtype was 14j/f (5/48; 10.4%), followed by 14b/f (4/48; 8.3%). To our knowledge, this report is the first study to investigate strain-type distribution of T. pallidum in Shandong. The high level of diversity of strain types may reflect a relatively long-term prevalence of infectious syphilis.4 In summary, we report a new sequence of the tp0548 gene of T. pallidum, which further expands the database of tp0548 gene sequence of T. pallidum and further expands our knowledge of the geographical distribution of T. pallidum strains. Further studies are needed to determine whether specific T. pallidum strain types are associated with the different clinical manifestations of syphilis. Hongqing Tian Shandong Clinical College of Skin Diseases Anhui Medical University Hefei, China Shandong Provincial Institute of Dermatology and Venereology School of Medicine and Life Sciences University of Jinan-Shandong Academy of Medical Sciences Jinan, Shandong, China Shandong Provincial Hospital for Skin Diseases Jinan, Shandong, China Shandong Provincial Medical Center for Dermatovenereology Jinan, Shandong, China Zhen Li Shandong Provincial Institute of Dermatology and Venereology School of Medicine and Life Sciences University of Jinan-Shandong Academy of Medical Sciences Jinan, Shandong, China Shandong Provincial Hospital for Skin Diseases Jinan, Shandong, China Shandong Provincial Key Lab for Dermatovenereology Jinan, Shandong, China Zhongwei Li Jianling Hou Rongtao Zheng Furong Li Ruyuan Liu Bing Liu Shandong Provincial Institute of Dermatology and Venereology School of Medicine and Life Sciences University of Jinan-Shandong Academy of Medical Sciences Jinan, Shandong, China Shandong Provincial Hospital for Skin Diseases Jinan, Shandong, China Chuan Wang Shandong Provincial Institute of Dermatology and Venereology School of Medicine and Life Sciences University of Jinan-Shandong Academy of Medical Sciences Jinan, Shandong, China Shandong Provincial Key Lab for Dermatovenereology Jinan, Shandong, China Furen Zhang, MD Shandong Clinical College of Skin Diseases Anhui Medical University Hefei, China Shandong Provincial Institute of Dermatology and Venereology School of Medicine and Life Sciences University of Jinan-Shandong Academy of Medical Sciences Jinan, Shandong, China Shandong Provincial Hospital for Skin Diseases Jinan, Shandong, China Shandong Provincial Medical Center for Dermatovenereology Jinan, Shandong, China Shandong Provincial Key Lab for Dermatovenereology Jinan, Shandong, China