Molecular identification of the first Galapagos fur seal (Arctocephalus galapagoensis) reported on the central coast of Oaxaca

Carlos Javier Tamayo-Millán,Adriana Cortés-Gómez,Dennis Bermúdez-Díaz,Ivon Marcela Chacón-Romo Leroux,Valentina Islas-Villanueva,Miguel Ángel Ahumada-Sempoal

doi:10.7773/cm.v47i3.3184

Abstract

Several sightings of different pinniped species have been recorded outside their typical areas of distribution. In May 2019, pinniped yearlings were sighted on 4 occasions on the central coast of Oaxaca, Mexico. One of them was found injured in La Escobilla (Oaxaca, Mexico) and was transported immediately to the Centro Mexicano de la Tortuga for rehabilitation. Visual identification of the species was inconclusive, as young individuals of several fur seal species can be very similar. A molecular analysis was thus performed to confirm the species. DNA was extracted from the individual, and a fragment of the mitochondrial DNA control region was sequenced and aligned with several sequences of other fur seal species. A parsimony analysis was performed, and the tree revealed that the individual was a Galapagos fur seal, Arctocephalus galapagoensis. This is the first record of this species on the central coast of Oaxaca. The atypical presence of this species in the country could be related to high sea surface temperatures associated with events such as El Niño.

Highlights

Four pinniped species belonging to 2 families can be found along the Pacific coast of Mexico, the northern elephant seal, Mirounga angustirostris (Gill 1866), and the harbor seal, Phoca vitulina richardsi (Gray 1864), in the Phocidae family, and the California sea lion, Zalophus californianus (Lesson 1828), and the Guadalupe fur seal, Arctocephalus philippii townsendi (Peters 1866), in the Otariidae family
A 660-bp fragment of the mitochondrial DNA (mtDNA) control region was amplified with primers ZcalF (3′ CCTAAGACTCAAGGAAGAAGCA 5′) and ZcalR (3′ TGCACCTCATGGTTGTATGA 5′), which were designed in this study using a Z. californianus sequence (NC_008416.1)
Visual identification of marine mammals requires a level of expertise that is limited to highly trained individuals, limiting the proper documentation of atypical sightings

Summary

Introduction

Four pinniped species belonging to 2 families can be found along the Pacific coast of Mexico, the northern elephant seal, Mirounga angustirostris (Gill 1866), and the harbor seal, Phoca vitulina richardsi (Gray 1864), in the Phocidae family, and the California sea lion, Zalophus californianus (Lesson 1828), and the Guadalupe fur seal, Arctocephalus philippii townsendi (Peters 1866), in the Otariidae family. Pinniped populations are associated with geographic areas like coasts and islands where different food resources are available (Riedman 1990) Access to these resources is affected by the Introducción. A lo largo de la costa mexicana del Pacífico se pueden encontrar 4 especies de pinnípedos representadas en 2 familias, el elefante marino del norte, Mirounga angustirostris (Gill 1866), y la foca de puerto, Phoca vitulina richardsi (Gray 1864), de la familia Phocidae, y el lobo marino de California, Zalophus californianus (Lesson 1828), y el lobo fino de Guadalupe, Arctocephalus philippii townsendi (Peters 1866), de la familia Otariidae. Some atypical records in Mexico include Arctocephalus australis (Zimmerman 1783) in Oaxaca (Villegas-Zurita et al 2016), Eumetopias jubatus (Schreber 1776) in Colima (Ceballos et al 2010, Gallo-Reynoso et al 2020), Zalophus wollebaeki (Sivertsen 1953) in Chiapas, and Arctocephalus galapagoensis (Heller 1904) in Guerrero, Chiapas, and Michoacán (Aurioles-Gamboa et al 2004, Páez-Rosas et al 2017)

Objectives

Methods

Results

Conclusion