Abstract

Background. Broccoli is an early-ripening vegetable crop that contains many biologically active compounds and mineral elements. According to the Genesys database, the global genebank collections contain no more than 465 different broccoli accessions. Fourteen cultivars and hybrids developed in Russia are registered in the State Register of the Russian Federation. The need to improve the assortment in a number of important breeding target areas (small habitus, non-spawning, bud size, disease resistance, etc.) requires the use of new effective techniques, including marker-assisted selection methods and association mapping. In this regard, it seems relevant to evaluate the VIR collection of broccoli using molecular genetic markers, which will provide new source material for breeding.Materials and methods. A molecular genetic study involved 39 broccoli cultivars and hybrid populations of different geographical origin, with various biological characteristics, and for various uses. For the analysis, 35 markers of microsatellite sequences specific to the Brassica L. genome were selected. PCR products were separated by electrophoresis on a 3% agarose gel.Results and conclusions. As a result, 110 polymorphic fragments were identified. In the studied loci, 3 to 7 alleles were pinpointed. The discriminating power of markers ranged from 0.75 to 0.96, and averaged 0.91; the average number of fragments per marker was 4.4. Ten unique alleles and 12 rare alleles (found in less than 8% of the samples) were observed in the studied accessions. On the other hand, the 201 bp allele of the locus BC65 was found in 95% of accessions, that is, it was almost common. All used markers have a sufficiently high diagnostic value and can be recommended for DNA identification in broccoli cultivars. An analysis of the genetic similarity of the collection accessions, carried out in the DarWin program using the Unweighted Neighbor-Joining method, made it possible to establish four closely related clusters.

Highlights

  • Broccoli is an early-ripening vegetable crop that contains many biologically active compounds and mineral elements

  • Fourteen cultivars and hybrids developed in Russia are registered in the State Register of the Russian Federation

  • The need to improve the assortment in a number of important breeding target areas requires the use of new effective techniques, including marker-assisted selection methods and association mapping

Read more

Summary

Background

Broccoli is an early-ripening vegetable crop that contains many biologically active compounds and mineral elements. The need to improve the assortment in a number of important breeding target areas (small habitus, non-spawning, bud size, disease resistance, etc.) requires the use of new effective techniques, including marker-assisted selection methods and association mapping. In this regard, it seems relevant to evaluate the VIR collection of broccoli using molecular genetic markers, which will provide new source material for breeding. Цель настоящей работы заключалась в изучении генетического разнообразия сортов и гибридных популяций брокколи и оценке эффективности использования подобранного нами набора микросателлитных маркеров для анализа генетического полиморфизма. В настоящей работе SSR-маркеры впервые использованы для оценки межсортового полиморфизма, определения уровня генетического сходства между образцами стержневой коллекции брокколи из коллекции ВИР. Япония к-306 к-309 к-310 вр.к-159 вр.к-194 вр.к-202 вр.к-277 вр.к-326 вр.к-332 вр.к-333 вр.к-335 вр.к-341 вр.к-347 вр.к-350 вр.к-353

25-91 RZ OPV-12317
Findings
F: ACAGCAAGGATGTGTTGACG информации R
Full Text
Paper version not known

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call

Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.