Abstract
The significance of Ras-like proteins in the protozoa is relatively unexplored. In this report, a gene encoding a Ras-like nuclear (Ran) protein was identified in Giardia lamblia by a polymerase chain reaction-based cloning strategy. The sequence analyses suggest that the gene was intronless, and had short 5'-untranslated leader sequences in the corresponding mRNA up to -2, -4, or -29 bases upstream of the first initiation codon. The full-length cDNA sequence predicted a protein comprising 226 amino acids, in which the highly conserved functional motifs of the Ras superfamily were all preserved. This protein showed 52% identity to human TC4 and 50% identity to yeast Spi1 proteins, suggesting that it is closely related to the Ran proteins, and it was therefore designated gRan. gRan produced from recombinant Escherichia coli exhibited GTP binding activity by an overlay assay. In good agreement with the predicted size of gRan, a 27-kDa protein was identified in a lysate of G. lamblia by Western blotting using antiserum raised against recombinant gRan. The protein was further localized in both nuclei of G. lamblia by immunofluorescence staining. Recombinant gRan exhibited low affinity for GTP with a Kd value of 16.8 microM. The affinity was enhanced to a Kd value of 2.2 microM in the presence of 10 mM Mg2+. The intrinsic GTPase activity of gRan was observed only in the presence of 10 mM Mg2+ and had an estimated Km of 5.6 microM and a Kcat of 0.33/h. These observations demonstrate the presence of Ras-like proteins in the most primitive eukaryotic cells, G. lamblia, and infer that the Ran protein may play a functional role in the nuclei of this organism.
Highlights
The significanceof Ras-likeproteins in the protozoa is (ARF)and the Ras-related protein superfamiliynvolved in inrelatively unexplored
Among the various GTPases, the Ras-related proteins are of particular interest to usbecause the significance of these proteins in the primitive protozoan Giardia lamblia has never been reported
The increased complexity of cytological organization in cells of eukaryotic lineage requires more sophisticated intracellular communication and integratedregulation. These functions are partially fulfilled by myriad smg proteins
Summary
Lamblia trophozoites bRyNAzol B as described by the supplier(Biotecx, For RNA sequencing reaction, the annealed mixture was adde1d0 to Houston, TX).mRNA was purified by passing cellulRarNA through an of pl of transcription buffer containing 2m4M Tris-HC1(pH 8.0), 16mM oligo(dT)-cellulosecolumn as described elsewhere [18]I.n genomic DNA MgCl,, 8 rm dithiothreitol, 0.4mM of each deoxynucleotide, 10 units of preparation, cells were digestebdy 100pg/ml proteinaseK in the pres- avianmyeloblastosisvirusreversetranscriptase,and one of the ence of 0.1 M NaCl, 10 mM Tris-HC1 (pH 8.0), 25 rm EDTA, and 0.5% dideoxynucleotide(0.2 ~ dl dAlTP~, 0.2 mM ddCTP, 0.2 nm ddGTP, or 0.4. Skim milk in GTP-binding buffer containing 0.25% Tween 20, 2 mM dithiothreitol, 0.05 mM MgCl,, and 20 m Tris-HC1 (pH 7.7) for 30. Binding of GTP to recombinant gRan in solution was performed as describedelsewhere[24], but with some modifications. 601 GGTATGGACGCCGCC ACCCGAGAGCAGATTAACAAGGATCTCGAG GCCGTCAATAATGTG various concentrationsof [CY-~~PIG(2T-P12 PM with specific radioactivity of 2-20 nCi/pmol) in solution A containin5g0 mM phosphate buffer
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
