Abstract
A new member of the connexin gene family has been identified and designated rat connexin-31 (Cx31) based on its predicted molecular mass of 30,960 daltons. Cx31 is 270 amino acids long and is coded for by a single copy gene. It is expressed as a 1.7-kilobase mRNA that is detected in placenta, Harderian gland, skin, and eye. Cx31 is highly conserved and can be detected in species as distantly related to rat as Xenopus laevis. It exhibits extensive sequence similarity to the previously identified connexins, 58, 50, and 40% amino acid identity to Cx26, Cx32, and Cx43, respectively. When conservation of predicted phosphorylation sites is used to adjust the alignment of Cx31 to other connexins, a unique alignment of three predicted protein kinase C phosphorylation sites near the carboxyl terminus of Cx31 with three sites at the carboxyl terminus of Cx43 is revealed.
Highlights
A new member ofthe connexin gene family has been proteins of M, 21,000 and M, 28,000 were identified as major identified and designated rat connexin-31 (Cx31) structural components
Thecurrent study uses instead low stringency sperm DNA, 30 pg/ml yeast tRNA, and 2-5 ng/ml probe DNA at screening of a rat genomic library to isolate genes that code for connexin homologues to understand further the diversity, distribution, and phylogeny of this family of proteins. Using this alternate strategy we have identified a new member of the connexin gene family designated Cx31
Multiple Alignment-Multiple alignment of rat connexin-31 (RCx31) with eight other connexins was carried out (Fig. 6;positions inthe multiple alignment are referred to with the prefix MA). It includes all connexin homologues identified for which the full protein sequence is available, except for the bovine Cx43 recently published (Lash et al, 1990).The alignment shows a perfect conservation of the threecysteines in the first extracellular loop, but RCx31 has a single amino acid inserted between the first two cysteines in the second extracellular loop
Summary
With BglI, EcoRI, HindIII, KpnI,NheI, Sac11or XbaI, separated on a 0.8% agarose gel, and capillary transferred onto Hybond-N as described by Maniatis et al (1982). A single clone designated RGJ21 sequence and the translation of the nucleotide sequence that that cross-hybridized with RCx26,RCx32, and RCx43was revealed a 270-amino acid open reading frame coding for a identified andrestriction-mapped (Fig. 1).The remaining protein with a predicted molecular mass of960 Da. The clones are currently under further investigation, but three others that have been examined closely reveal no connexin homologues. The 4.4-kb fragment containingthe homologous sequence was subcloned, and 982 bases between the EcoRI predicted protein exhibits a high degree of similarity to previously characterized connexins, 58, 50, and 40% amino acid identity, and 65, 58, and 51% nucleotide identity to RCx26, RCx32, and RCx43, respectively. Single HindIII bands of 3.0, 18, and 4.1 kb are seen in the rat, mouse, and frog DNAs, respectively. --- CAG GCT TCA GCG CCT AGC CTG ACC CCC ATT TAA CCACGCGCTGGAGAAGGGGTGAGGCTGGGAGGTG
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
