Abstract

Simple SummaryIn this study, we found that RNF20 is ubiquitously expressed in porcine tissues, and the sequence of the RING domain was highly conserved across different species. Eight potential single nucleotide polymorphisms (SNPs) were discovered, and one of them, SNP1 (A-1027G), was confirmed by PCR-restriction fragment length polymorphism (RFLP). Allele frequency differences were also analyzed in four pig breeds. This study provides a preliminary understanding of the porcine RNF20 gene.Fat deposition is considered an economically important trait in pig breeding programs. Ring finger protein 20 (RNF20), an E3 ubiquitin protein ligase, has been shown to be closely involved in adipogenesis in mice, suggesting its conserved role in pigs. In this study, we obtained the exon sequences of the porcine RNF20 gene and characterized its molecular sequence. The porcine RNF20 gene contains 20 exons that encode 975 amino acids, and its RING domain is highly conserved across different species. Western blot analysis revealed that RNF20 was widely expressed, especially in various fat depots, and the level of H2B monoubiquitination (H2Bub) was highly consistent. Eight potential SNPs were detected by sequencing pooled PCR fragments. PCR–RFLP was developed to detect a single nucleotide polymorphism (A-1027G) in exon 1, and the allele frequency differences were examined in four pig breeds. The G allele was predominant in these pigs. Association analysis between (A-1027G) and the backfat thickness of three commercial pig breeds was performed, but no significant association was found. Taken together, these results enabled us to undertake the molecular characterization, expression profiling, and SNP analysis of the porcine RNF20 gene.

Highlights

  • Ring finger protein 20 (RNF20), an ortholog of yeast Brel 1a, is an E3 ligase that ubiquitinates histone H2B 120 lysine [1]

  • To obtain the predicted exon sequences and detect the putative single nucleotide polymorphisms (SNPs) in the porcine RNF20 gene, 10 pooled DNA samples (2 μg per sample; 2 samples per breed, including Yorkshire, Landrace, Duroc, and Min, as we described above, and 2 DNA samples from Meishan pigs that we kept in our lab) were used as a PCR template

  • To further investigate the molecular characterization of the porcine RNF20 gene, bioinformatic analysis was performed based on the coding sequences (CDSs) sequence

Read more

Summary

Introduction

Ring finger protein 20 (RNF20), an ortholog of yeast Brel 1a, is an E3 ligase that ubiquitinates histone H2B 120 lysine [1]. A recent report found that Rnf is highly expressed in fat tissues from high-fat diet-fed mice compared to those from chow diet-fed mice, and Rnf heterozygous mice (Rnf20+/− ) exhibited significantly reduced fat mass compared to wild-type littermates [18]. Taken together, these data demonstrated that RNF20 plays a key role in fat deposition in rodents. Over the past several decades, many locis that affect fat deposition and backfat thickness have been identified by association studies, linkage analysis, and GWAS [21]. The preliminary association between SNP1 and BFT in commercial breeds was further examined

Populations and DNA Samples
PCR Amplification
F: TGGGGAAGTGTGTAATGGGTA
Western Blot Analysis
PCR–RFLP
Association Analysis
Exon Sequences of the Porcine RNF20 Gene
Bioinformatic Analysis of the RNF20 Gene
Alignment
RNF20 Is Ubiquitously Expressed in Porcine Tissues
Expression
Potential SNPs Identification
Genotype and Allele
Association Analysis of SNP1 with Backfat Thickness
Discussion
Conclusions
Full Text
Published version (Free)

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call