Molecular assessment of demersal fish diversity in Prydz Bay using DNA taxonomy

In 2013, the 29th Chinese National Antarctic Research Expedition (CHINARE) prospected the Prydz Bay on the Antarctic continental shelf, and the Chinese R/V Xuelong icebreaker sampled all of the examined locations. The nature of Antarctic fish diversity in the high-latitude Prydz Bay is virtually unknown, and the accuracy of relevant estimates has not been established. Thus, it is necessary to evaluate this diversity and propose protective measures. In total, ninety-nine specimens were collected from various locations. To overcome uncertainties associated with identifying species based on morphology, DNA barcoding (COI gene) was employed to reconstruct phylogenetic relationships with delimited references from NCBI. Twenty-two species representing six families were unambiguously identified from a neighbor-joining (NJ) tree and barcoding gaps. With the morphological identification, thirteen species were identified correctly, five species were identified correctly at the genus level, and four species were identified at the close sister species level. Notothenioid dominance was not evident in the Prydz Bay, in contrast to other published studies. The low species diversity and catch biomass during this CHINARE were severely constrained by limited fishing methods and localized sites, which led to biased underestimation. Our analyses indicate that DNA barcoding is an effective tool for the identification of fish species in the Prydz Bay. The identification and distribution of Antarctic fish should be an integral component of understanding Antarctic fish biodiversity and biogeography, and large-scale studies are necessary for the further taxonomic identification of Antarctic fish.

The Southern Ocean is experiencing complex climate change, and the Amundsen Sea is one of the regions that has responded most rapidly to climate change. Due to their role in ecosystems, environmental sensitivity and high endemism, Antarctic demersal fish are a favorable group that can act as an indicator of the response of Antarctic organisms to climate change. However, our knowledge of Antarctic fish fauna is insufficient, with knowledge gaps even in their taxonomy. This situation is greatly influenced by the limitations of traditional taxonomy and thus calls for alternative solutions such as DNA barcoding. In this study, DNA barcoding analyses of 69 fish samples obtained from the Amundsen Sea were conducted using the mitochondrial COI gene. Based on the molecular species delimitation results, 13 fish species were found to belong to two orders, six families, and 12 genera. Both the maximum likelihood and Bayesian inference methods showed that the phylogenetic relationships of Bathydraconidae were paraphyletic, which was consistent with previous phylogenetic research. Our research showed that the COI gene, as a DNA barcode, is not only suitable for the identification of Antarctic fish species but also reflects some phylogenetic characteristics that might provide important evidence and support for studies of Antarctic fish phylogenetic relationships. In summary, our study provides an important reference for fish diversity and taxonomy in the Amundsen Sea, which may further enhance our understanding of the biodiversity, taxonomy and biogeography of fish in this area.

BackgroundThe 5’ region of cytochrome oxidase I (COI) is the standard marker for DNA barcoding. However, COI has proved to be of limited use in identifying some species, and for some taxa, the coding sequence is not efficiently amplified by PCR. These deficiencies lead to uncertainty as to whether COI is the most suitable barcoding fragment for species identification of ticks.MethodsIn this study, we directly compared the relative effectiveness of COI, 16S ribosomal DNA (rDNA), nuclear ribosomal internal transcribed spacer 2 (ITS2) and 12S rDNA for tick species identification. A total of 307 sequences from 84 specimens representing eight tick species were acquired by PCR. Besides the 1,834 published sequences of 189 tick species from GenBank and the Barcode of Life Database, 430 unpublished sequences representing 59 tick species were also successfully screened by Bayesian analyses. Thereafter, the performance of the four DNA markers to identify tick species was evaluated by identification success rates given by these markers using nearest neighbour (NN), BLASTn, liberal tree-based or liberal tree-based (+threshold) methods.ResultsGenetic divergence analyses showed that the intra-specific divergence of each marker was much lower than the inter-specific divergence. Our results indicated that the rates of correct sequence identification for all four markers (COI, 16S rDNA, ITS2, 12S rDNA) were very high (> 96%) when using the NN methodology. We also found that COI was not significantly better than the other markers in terms of its rate of correct sequence identification. Overall, BLASTn and NN methods produced higher rates of correct species identification than that produced by the liberal tree-based methods (+threshold or otherwise).ConclusionsAs the standard DNA barcode, COI should be the first choice for tick species identification, while 16S rDNA, ITS2, and 12S rDNA could be used when COI does not produce reliable results. Besides, NN and BLASTn are efficient methods for species identification of ticks.

Integrated DNA Barcoding and Morphometric Characterization of Palm Weevils (Rhynchophorus spp.) in North Sulawesi

Only 10% of the earth’s biota has been described despite250 yearsoftaxonomicresearch(Wilson2000).Thisisinlargepart a reflection of the extent and complexity of biologicaldiversity,butitisalsotruethattraditionaltaxonomictechniquesare labourious and highly specialised, and taxonomic expertiseis very thinly spread across the myriad groups of life (Scotland

DNA barcoding and morphological characters were used to identify adult snails belonging to the genus Biomphalaria from 17 municipalities in the state of São Paulo, Brazil. The DNA barcode analysis also included twenty-nine sequences retrieved from GenBank. The final data set of 104 sequences of the mitochondrial cytochrome oxidase I (COI) gene was analyzed for K2P intraspecific and interspecific divergences, through tree-reconstruction methods (Neighbor-Joining, Maximum Likelihood and Bayesian inference), and by applying different models (ABGD, bPTP, GMYC) to partition the sequences according to the pattern of genetic variation. Twenty-seven morphological parameters of internal organs were used to identify specimens. The molecular taxonomy of Biomphalaria agreed with the morphological identification of specimens from the same collection locality. DNA barcoding may therefore be a useful supporting tool for identifying Biomphalaria snails in areas at risk for schistosomiasis.

A community functional structure may respond to environmental changes such as nitrogen (N) enrichment by altering intraspecific and interspecific trait variations. However, the relative contributions of both components in determining the community response to N enrichment are unclear. In this study, we measured the plant height (H), leaf area (LA), leaf dry matter content (LDMC), and specific leaf area (SLA) based on a nine-year N addition gradient experiment in an alpine meadow on the Tibetan Plateau. We examined the intraspecific and interspecific variations within and among the communities, the responses of traits in terms of community weighted mean (CWM) and non-weighted mean (CM) to N addition, and the effects of these trait variations on aboveground net primary productivity (ANPP). Our results show that N addition increased the interspecific variation in H while decreasing that of LA within the community, whereas it had no significant effects on the intraspecific variations in the four traits within the community. In contrast, N addition significantly increased the intraspecific variation in H and decreased that of LA among the communities. Moreover, the contribution of intraspecific variation was greater than that of the interspecific variation in terms of CWM for all traits, while the opposite contribution was observed in terms of CM, suggesting that the dominant species would have greater resilience while subdominant species would become less resistant to N addition. Further, intraspecific variations of LA and LDMC within the community played an important role in explaining community productivity. Our results highlight the importance of both intraspecific and interspecific variations in mediating functional trait responses to N enrichment, and intraspecific variation within the communities has important implications for community functioning that should be considered to better understand and predict the responses of the alpine grasslands to N enrichment.

Identification of adult fruit flies primarily involves microscopic examination of diagnostic morphological characters, while immature stages, such as larvae, can be more problematic. One of the Australia's most serious horticultural pests, the Queensland Fruit Fly (Bactrocera tryoni: Tephritidae), is of particular biosecurity/quarantine concern as the immature life stages occur within food produce and can be difficult to identify using morphological characteristics. DNA barcoding of the mitochondrial Cytochrome Oxidase I (COI) gene could be employed to increase the accuracy of fruit fly species identifications. In our study, we tested the utility of standard DNA barcoding techniques and found them to be problematic for Queensland Fruit Flies, which (i) possess a nuclear copy (a numt pseudogene) of the barcoding region of COI that can be co-amplified; and (ii) as in previous COI phylogenetic analyses closely related B.tryoni complex species appear polyphyletic. We found that the presence of a large deletion in the numt copy of COI allowed an alternative primer to be designed to only amplify the mitochondrial COI locus in tephritid fruit flies. Comparisons of alternative commonly utilized mitochondrial genes, Cytochrome Oxidase II and Cytochrome b, revealed a similar level of variation to COI; however, COI is the most informative for DNA barcoding, given the large number of sequences from other tephritid fruit fly species available for comparison. Adopting DNA barcoding for the identification of problematic fly specimens provides a powerful tool to distinguish serious quarantine fruit fly pests (Tephritidae) from endemic fly species of lesser concern.

Species identification is a difficult task, ranging from the definition of the species concept itself to the definition of the threshold for speciation. DNA Barcode technology uses a fragment of the Cytochrome Oxidase I (COI) gene as a molecular tool that many studies have already validated as a tool for species identification. DNA barcode sequences for COI were generated and analyzed from 805 specimens. The General Mixed Yule Coalescent (GMYC) analysis recognized 99 independent evolution units, and the Barcode Index Numbers (BIN) approach pointed to the existence of 104 BINs (interpreted as distinct species). By cross-tabulating the results of all approaches, we identified 109 Molecular Operational Taxonomic Units (MOTU) by at least one methodology. In most cases (89 MOTUs), the genetic approaches are in agreement with morphological identification, and the discrepant results of MOTUs are in the complex groups, which have many morphological similarities but may represent species complexes.

The Cosmonaut Sea is one of the least accessed regions in the Southern Ocean, and our knowledge about the fish biodiversity in the region is sparse. In this study, we provided a description of demersal fish diversity in the Cosmonaut Sea by analysing cytochrome oxidase I (COI) barcodes of 98 fish samples that were hauled by trawling during the 37th and 38th Chinese National Antarctic Research Expedition (CHINARE) cruises. Twenty-four species representing 19 genera and 11 families, namely, Artedidraconidae, Bathydraconidae, Bathylagidae, Channichthyidae, Liparidae, Macrouridae, Muraenolepididae, Myctophidae, Nototheniidae, Paralepididae and Zoarcidae, were discriminated and identified, which were largely identical to local fish occurrence records and the general pattern of demersal fish communities at high Antarctic shelf areas. The validity of a barcoding gap failed to be detected and confirmed across all species due to the indicative signals of two potential cryptic species. Nevertheless, DNA barcoding still demonstrated to be a very efficient and sound method for the discrimination and classification of Antarctic fishes. In the future, various sampling strategies that cover all geographic sections and depth strata of the Cosmonaut Sea are encouraged to enhance our understanding of local fish communities, within which DNA barcoding can play an important role in either molecular taxonomy or the establishment of a dedicated local reference database for eDNA metabarcoding analyses.

DNA barcoding for conservation and management of Amazonian commercial fish

Eight years after DNA barcoding was formally proposed on a large scale, CO1 sequences are rapidly accumulating from around the world. While studies to date have mostly targeted local or regional species assemblages, the recent launch of the global iBOL project (International Barcode of Life), highlights the need to understand the effects of geographical scale on Barcoding's goals. Sampling has been central in the debate on DNA Barcoding, but the effect of the geographical scale of sampling has not yet been thoroughly and explicitly tested with empirical data. Here, we present a CO1 data set of aquatic predaceous diving beetles of the tribe Agabini, sampled throughout Europe, and use it to investigate how the geographic scale of sampling affects 1) the estimated intraspecific variation of species, 2) the genetic distance to the most closely related heterospecific, 3) the ratio of intraspecific and interspecific variation, 4) the frequency of taxonomically recognized species found to be monophyletic, and 5) query identification performance based on 6 different species assignment methods. Intraspecific variation was significantly correlated with the geographical scale of sampling (R-square = 0.7), and more than half of the species with 10 or more sampled individuals (N = 29) showed higher intraspecific variation than 1% sequence divergence. In contrast, the distance to the closest heterospecific showed a significant decrease with increasing geographical scale of sampling. The average genetic distance dropped from > 7% for samples within 1 km, to < 3.5% for samples up to > 6000 km apart. Over a third of the species were not monophyletic, and the proportion increased through locally, nationally, regionally, and continentally restricted subsets of the data. The success of identifying queries decreased with increasing spatial scale of sampling; liberal methods declined from 100% to around 90%, whereas strict methods dropped to below 50% at continental scales. The proportion of query identifications considered uncertain (more than one species < 1% distance from query) escalated from zero at local, to 50% at continental scale. Finally, by resampling the most widely sampled species we show that even if samples are collected to maximize the geographical coverage, up to 70 individuals are required to sample 95% of intraspecific variation. The results show that the geographical scale of sampling has a critical impact on the global application of DNA barcoding. Scale-effects result from the relative importance of different processes determining the composition of regional species assemblages (dispersal and ecological assembly) and global clades (demography, speciation, and extinction). The incorporation of geographical information, where available, will be required to obtain identification rates at global scales equivalent to those in regional barcoding studies. Our result hence provides an impetus for both smarter barcoding tools and sprouting national barcoding initiatives—smaller geographical scales deliver higher accuracy.

Oysters (family Ostreidae), with high levels of phenotypic plasticity and wide geographic distribution, are a challenging group for taxonomists and phylogenetics. As a useful tool for molecular species identification, DNA barcoding might offer significant potential for oyster identification and taxonomy. This study used two mitochondrial fragments, cytochrome c oxidase I (COI) and the large ribosomal subunit (16S rDNA), to assess whether oyster species could be identified by phylogeny and distance-based DNA barcoding techniques. Relationships among species were estimated by the phylogenetic analyses of both genes, and then pairwise inter- and intraspecific genetic divergences were assessed. Species forming well-differentiated clades in the molecular phylogenies were identical for both genes even when the closely related species were included. Intraspecific variability of 16S rDNA overlapped with interspecific divergence. However, average intra- and interspecific genetic divergences for COI were 0-1.4% (maximum 2.2%) and 2.6-32.2% (minimum 2.2%), respectively, indicating the existence of a barcoding gap. These results confirm the efficacy of species identification in oysters via DNA barcodes and phylogenetic analysis.

Abstract. Dwifajri S, Tapilatu RF, Pranata B, Kusuma AB. 2022. Molecular phylogeny of grouper of Epinephelusgenus in Jayapura, Papua, Indonesiainferred from Cytochrome Oxidase I (COI) gene. Biodiversitas 23: 1449-1456. Grouper (Serranidae: Epinephelinae: Epinephelus) fish have high economic value, and are relatively overfis hed, yet have not received serious attention to determine conservation status by the International Union for Conservation of Nature (IUCN). DNA barcoding is an important molecular approach to identify Papua's grouper species. The objective of the present study was to analyze species diversity and molecular phylogeny of Epinephelus grouper based on DNA sequences of mitochondrial control region COI gene. Samples of grouper fish were collected from Hamadi, Sentani, and Youtefa local fish markets in Jayapura, Papua during August 2020. Grouper was morphologically identified, photographed and its fin was clipped and preserved for molecular analysis. Present study used primers, i.e., Fish R1 5'TAGACTTCTGGCCAAGAATCA3' and Fish F1 5'TCAACCAACCACAAAGACATTGGCA3'. Based on gene bank comparison at the sequence length 689 base pairs, the present study obtained seven species of grouper (Serranidae: Epinephelinae), namely Epinephelus areolatus, Epinephelus coioides, Epinephelus episictus, Epinephelus kupangensis, Epinephelus macrospilos, Epinephelus melanostigma and Epinephelus merra. The phylogenetic tree was composed of seven clades, where each grouper species represented each clade. The genetic distance between Epinephelus kupangensis and Epinephelus melanostigma was determined as the closest genetic distance (0.123) in the present study, while the farthest one was found between Epinephelus episictus and Epinephelus merra (0.161).

Assessment of fish diversity in the South China Sea using DNA taxonomy