Molecular and morphological data to facilitate future research on freshwater mussels (Bivalvia: Unionidae: Anodontinae)

Chase H Smith,Nathan A Johnson,John M Pfeiffer,Michael M Gangloff

doi:10.1016/j.dib.2017.12.050

Abstract

This data article presents the multi-locus DNA alignments, morphometric data, and details on specimens examined to resolve the evolutionary history of Anodontoides and Strophitus, primarily generic placement and species boundaries. We sequenced 3 loci to create our molecular matrix: cytochrome c oxidase subunit I, NADH dehydrogenase subunit I, and the nuclear-encoded ribosomal internal transcribed spacer I. Aligned sequences were used in phylogenetic analyses and to identify diagnostic nucleotides for Strophitus pascagoulaensis, Strophitus radiatus, Strophitus sp. cf. pascagoulaensis, and Strophitus williamsi. Linear morphometrics (i.e. maximum height, length, and width) were also implemented to further evaluate species boundaries within Strophitus. For further details and experimental findings, please refer to the article published in Molecular Phylogenetics and Evolution (Smith et al., 2018) [1].

Highlights

This data article presents the multi-locus DNA alignments, morphometric data, and details on specimens examined to resolve the evolutionary history of Anodontoides and Strophitus, primarily generic placement and species boundaries
Morphometric measurements, specimen collection details, and diagnostic nucleotides for taxa previously recognized as Anodontoides radiatus Bidirectional sequencing on an ABI 3730, digital calipers, and phylogenetic methods Aligned consensus gene sequences, raw measurements, analyzed diagnostic sites DNA was extracted from freshwater mussel mantle tissue
We present multi-locus sequence data for 97 individuals representing 18 species of North American freshwater mussels (Bivalvia: Unionidae) belonging to the subfamily Anodontinae

Summary

Molecular data collection

Our taxon sampling focused on North American freshwater mussels in the subfamily Anodontinae (Table 1). We sequenced two mitochondrial genes and one nuclear gene for phylogenetic analyses:. – – – MG199860 MG199861 the protein-coding mitochondrial genes cytochrome c oxidase subunit I (COI) and NADH dehydrogenase subunit I (NDI), and the nuclear-encoded ribosomal internal transcribed spacer I (ITSI). Primers used for polymerase chain reaction (PCR) and sequencing were: COI dgLCO-1490— GGTCAACAAATCATAAAGAYATYGG and COI dgHCO-2198—TAAACTTCAGGGTGACCAAARAAYCA [3]; NDI Leu-uurF- TGGCAGAAAAGTGCATCAGATTAAAGC and LoGlyR—CCTGCTTGGAAGGCAAGTGTACT [4]; ITSI-18S—AAAAAGCTTCCGTAGGTGAACCTGCG and ITSI-5.8 S—AGCTTGCTGCGTTCTTCATCG [5]. PCR amplifications were conducted using a 25 μl mixture of the following: distilled deionized water (9.5 μl), GoTaq GMM (12.5 μl) (Green Master Mix, Promega Corporation), primers (0.5 μl each) and DNA template (40 ng). Product was sent to the Interdisciplinary Center for Biotechnology Research at the University of Florida for bi-directional sequencing on an ABI 3730

Molecular data processing

Morphological data collection