Abstract
Multidrug resistance (MDR) is a phenomenon that is often associated with decreased intracellular drug accumulation in patient's tumor cells resulting from enhanced drug efflux. It is related to the overexpression of a membrane protein, P-glycoprotein (Pgp-170), thereby reducing drug cytotoxicity. A variety of studies have tried to find MDR modulators which increase drug accumulation in cancer cells. In this study, natural curcuminoids, pure curcumin, demethoxycurcumin and bisdemethoxycurcumin, isolated from turmeric (Curcuma longa Linn), were compared for their potential ability to modulate the human MDR-1 gene expression in multidrug resistant human cervical carcinoma cell line, KB-V1 by Western blot analysis and RT-PCR. Western blot analysis and RT-PCR showed that all the three curcuminoids inhibited MDR-1 gene expression, and bisdemethoxycurcumin produced maximum effect. In additional studies we found that commercial grade curcuminoid (approximately 77% curcumin, 17% demethoxycurcumin and 3% bisdemthoxycurcumin) decreased MDR-1 gene expression in a dose dependent manner and had about the same potent inhibitory effect on MDR-1 gene expression as our natural curcuminoid mixtures. These results indicate that bisdemethoxycurcumin is the most active of the curcuminoids present in turmeric for modulation of MDR-1 gene. Treatment of drug resistant KB-V1 cells with curcumin increased their sensitivity to vinblastine, which was consistent with a decreased MDR-1 gene product, a P-glycoprotein, on the cell plasma membrane. Although many drugs that prevent the P-glycoprotein function have been reported, this report describes the inhibition of MDR-1 expression by a phytochemical. The modulation of MDR-1 expression may be an attractive target for new chemosensitizing agents.
Highlights
Multidrug resistance (MDR) is a phenomenon that is often associated with decreased intracellular drug accumulation in patient's tumor cells resulting from enhanced drug efflux
We demonstrate that bisdemethoxycurcumin is the most active of the curcuminoids present in turmeric for modulation of MDR-1 gene
(page number not for citation purposes) http://www.biomedcentral.com/1471-2407/4/13 decided to use these cell lines to assess the effect of curcuminoids on the expression of Pgp
Summary
General Silica gel 60 and petroleum ether was purchased from Merck. Commercial grade curcuminoids (77% curcumin, 17% demethoxycurcumin and 3% bisdemethoxycurcumin) and mouse monoclonal anti-P-glycoprotein (MDR) clone F4 were purchased from Sigma-Aldrich. Western blot analysis and ECL detection The cell membrane proteins (10 μg/lane) were separated by a 7.5% SDS-polyacrylamide gel electrophoresis and electroblotted overnight onto nitrocellulose filters. CACAAAATT and the reverse primer sequence used was CAGACAGCAGCTGACAGTCCAAGAACAGGACT, corresponding to residues 406–437 and residues 657–688, respectively, of the published cDNA sequence [21] Using these primers, PCR yields gave a 283-bp product. Evaluation of β-actin expression, used as control of the RNA amount, was carried out by using the forward primer sequence CAGAGCAAGAGAGGCATCCT and the reverse primer sequence TTGAAGGTCTCAAACATGAT corresponding to residues 216–235 and residues 405–424, respectively, which yield a 201-bp product. PcFogigpmuemrxeprr2ceisasl igornadine KcuBr-cVu1mcienlolsidcumltiuxrtuerdeisnfo1,r53, danayds μM Pgp expression in KB-V1 cells cultured in 1, 5, and 10 μM commercial grade curcuminoid mixtures for 3 days The Pgp protein level was determined by Western blotting using Mab F4 (top), and quantified by laser densitometry (bottom). Results were considered to be statistically significant when P < 0.05
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
