Abstract
Mad:Max heterodimers oppose the growth-promoting action of Myc:Max heterodimers by recruiting the mSin3-histone deacetylase (mSin3. HDAC) complex to DNA and functioning as potent transcriptional repressors. There are four known members of the Mad family that are indistinguishable in their abilities to interact with Max, bind DNA, repress transcription, and block Myc + Ras co-transformation. To investigate functional differences between Mad family proteins, we have identified additional proteins that interact with this family. Here we present the identification and characterization of the novel basic-helix-loop-helix zipper protein Mlx (Max-like protein x), which is structurally and functionally related to Max. The similarities between Mlx and Max include 1) broad expression in many tissues, 2) long protein half-life, and 3) formation of heterodimers with Mad family proteins that are capable of specific CACGTG binding. We show that transcriptional repression by Mad1:Mlx heterodimers is dependent on dimerization, DNA binding, and recruitment of the mSin3A.HDAC corepressor complex. In contrast with Max, Mlx interacts only with Mad1 and Mad4. Together, these findings suggest that Mlx may act to diversify Mad family function by its restricted association with a subset of the Mad family of transcriptional repressors.
Highlights
The basic-helix-loop-helix-zipper1 (BHLHZip)1 protein Max is an essential component in a transcription factor network that functions to regulate cell growth and differentiation [1, 2]
These findings suggest that Max-like protein X (Mlx) may act to diversify Mad family function by its restricted association with a subset of the Mad family of transcriptional repressors
Myc:Max heterocomplexes function as transcriptional activators (10 –12), whereas Mad:Max [6, 7, 13] and Mnt:Max heterocomplexes function as transcriptional repressors [9]
Summary
Two-hybrid Screen and Cloning—Yeast two-hybrid screening was performed as described previously using a VP16 library constructed from mRNA isolated from mouse embryos at 9.5 and 10.5 days p.c. [31, 48]. 80 VP16 fusion clones were chosen for characterization. In ⌬BRMlx, Glu-84 and Gln-85 of the basic region of Mlx were mutated to glycine and proline, respectively These mutations abolish Mlx DNA binding (data not shown). VP16Mad and LexAMlx were constructed by amplifying the Mad or Mlx cDNA by polymerase chain reaction and cloning the products into pBTM116 or pVP16 [48], respectively. Three rounds of infection were performed in the presence of 8 g mlϪ1 Polybrene, and cells were assayed for Mlx expression by indirect immunofluorescence. To determine if cycloheximide was effective at blocking protein synthesis at this concentration, control cells were treated for 1 h with the drug and labeled with [35S]methionine/cysteine (NEN Life Science Products) for 30 min. Each transfection contained 400 ng of luciferase reporter, 100 ng CMV--galactosidase, 1 g of expression construct, and carrier DNA to a total of 5 g of DNA. The luciferase reporter pGL3-CM2 was constructed by inserting four copies of the E-box-containing sequence CCCAGTCGCACGTGCTGTAGG between the SacI and BglII sites of pGL3-promoter (Promega)
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
