Abstract

Objective To investigate the mechanism of miR-30a-5p inhibiting proliferation and migration of lung squamous cell carcinoma (LSCC) cells by targeting FOXD1. Methods Bioinformatics was used to analyze differentially expressed genes in the TCGA_LUSC database. qRT-PCR was used to detect the expression levels of miR-30a-5p and FOXD1 in human normal lung epithelial cell line and human LSCC cell lines. The protein expression of FOXD1 was detected by western blot. The cell viability and colony formation abilities were examined by CCK-8 and colony formation assays, respectively. Wound healing and Transwell assays were performed to examine the migration and invasion abilities of cells. The targeted binding sites of miR-30a-5p and FOXD1 were predicted by bioinformatics, and dual luciferase assay was used to verify the targeted binding relationship between miR-30a-5p and FOXD1. Result miR-30a-5p was downregulated in LSCC tissues and cells, while FOXD1 was highly expressed. Overexpression of miR-30a-5p or silencing FOXD1 inhibited cell viability, colony formation ability, migration, and invasion of LSCC cells. miR-30a-5p inhibited the proliferation and migration of LSCC cells by downregulating the expression of FOXD1. Conclusion miR-30a-5p can downregulate the expression of FOXD1 and inhibit the proliferation and migration of LSCC.

Highlights

  • Lung cancer is one of the main causes of cancer-related deaths worldwide

  • We explored the targeted relationship between miR-30a-5p and FOXD1 to identify the potential mechanism underlying proliferation and migration of lung squamous cell carcinoma (LSCC) cell lines and to find out a new targeted therapeutic approach for LSCC

  • The NCI-H520 cells were grouped into NC mimic+oeNC group, miR-30a-5p mimic+oe-NC group, and miR30a-5p mimic+oe-FOXD1 group to analyze the effects of miR-30a-5p on the proliferation and migration of LSCC cells by targeted regulating FOXD1 expression

Read more

Summary

Objective

To investigate the mechanism of miR-30a-5p inhibiting proliferation and migration of lung squamous cell carcinoma (LSCC) cells by targeting FOXD1. QRT-PCR was used to detect the expression levels of miR-30a-5p and FOXD1 in human normal lung epithelial cell line and human LSCC cell lines. The cell viability and colony formation abilities were examined by CCK-8 and colony formation assays, respectively. Wound healing and Transwell assays were performed to examine the migration and invasion abilities of cells. MiR-30a-5p was downregulated in LSCC tissues and cells, while FOXD1 was highly expressed. Overexpression of miR-30a-5p or silencing FOXD1 inhibited cell viability, colony formation ability, migration, and invasion of LSCC cells. MiR-30a-5p inhibited the proliferation and migration of LSCC cells by downregulating the expression of FOXD1. MiR-30a-5p can downregulate the expression of FOXD1 and inhibit the proliferation and migration of LSCC Conclusion. miR-30a-5p can downregulate the expression of FOXD1 and inhibit the proliferation and migration of LSCC

Introduction
Materials and Methods
F: AAGAACCCGCTGGTGAAG R: GTCCAGTAGTTGCCCTTGC F: ACAACTTTGGTATCGTGGAAGG R
Result
Discussion
Conflicts of Interest

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call

Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.