Year-end Sale % OFF 
Abstract
By influencing the activity of the PI3K/AKT pathway, IL-6 acts as an important regulator of hepatic insulin resistance. miR-200s have been shown to control growth by regulating PI3K, but the role of miR-200s in the development of hepatic insulin resistance remains unclear. The present study showed that elevated serum concentration of IL-6 is associated with decreased levels of miR-200s, impaired activation of the AKT/glycogen synthase kinase (GSK) pathway, and reduced glycogenesis that occurred in the livers of db/db mice. As shown in the murine NCTC 1469 hepatocytes and the primary hepatocytes treated with 10 ng/ml IL-6 for 24 h and in 12-week-old male C57BL/6J mice injected with 16 μg/ml IL-6 by pumps for 7 days, IL-6 administration induced insulin resistance through down-regulation of miR-200s. Moreover, IL-6 treatment inhibited the phosphorylation of AKT and GSK and decreased the glycogenesis. The effects of IL-6 could be diminished by suppression of FOG2 expression. We concluded that IL-6 treatment may impair the activities of the PI3K/AKT/GSK pathway and inhibit the synthesis of glycogen, perhaps via down-regulating miR-200s while augmenting FOG2 expression.
Highlights
MiR-200s have been shown to control growth by regulating PI3K, but the role of miR-200s in the development of hepatic insulin resistance remains unclear
As shown in the murine NCTC 1469 hepatocytes and the primary hepatocytes treated with 10 ng/ml IL-6 for 24 h and in 12-week-old male C57BL/6J mice injected with 16 g/ml IL-6 by pumps for 7 days, IL-6 administration induced insulin resistance through downregulation of miR-200s
We found that the expression of miR-200s was decreased in the livers of db/db mice, accompanied by an elevated level of IL-6
Summary
Animals—We obtained db/db mice (C57BL/KsJ) from the Peking University Health Science Center (originally purchased form Jackson Laboratory). 12-week-old male C57BL/6J mice were provided from the Peking University Health Science Center. Isolation of Mouse Primary Hepatocytes—Male C57BL/6J mice (12 weeks old) were provided from the Peking University Health Science Center. 48 h after transfection, the expression of miR-200s was detected by real-time PCR. A stem-loop reverse transcription-polymerase chain reaction (RT-PCR) was executed on samples to detect and quantify mature miRNAs by using stem-loop antisense primer mix and avian myeloblastosis virus transcriptase (TaKaRa). The cDNA preparations were routinely tested by real-time PCR based on the SYBR Green I method, according to the manufacturer’s instructions (TaKaRa). The nucleotide primers used for real-time PCR were as follows (5Ј-3Ј): miR-200a forward, GCTAACACTGTCTGGTAACGATGT; miR-200b forward, GCGTAATACTGCCTGGTAATGATG; miR-200c forward, GTAATACTGCCGGGTAATGATGGA; U6 forward, GCGCGTCGTGAAGCGTTC; universal reverse primer, GTGCAGGGTCCGAGGT. A one-way analysis of variance test was used to determine significance, with values of p Ͻ 0.05 indicating statistical significance
Sign-in/Register to view highlights & summary 
Published Version (
Free)
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
