Microsatellites in the Endangered Species Dyckia distachya (Bromeliaceae) and Cross-Amplification in Other Bromeliads

Camila Zanella,Fernanda Bered,Gecele Paggi,Aline Janke,Márcia Goetze,Mauricio Reis

doi:10.3390/ijms131215859

Abstract

Microsatellite markers were isolated in Dyckia distachya, an endangered bromeliad from southern Brazil, which will be useful to assess the population genetic structure and reproductive success in introduced and natural populations of this species. Twenty microsatellite loci were developed from an enriched genomic library, and nine of these were amplified. The loci were characterized in 43 individuals from introduced and wild D. distachya populations. All nine loci were polymorphic, with four to ten alleles per locus. In an introduced population the observed and expected heterozygosities ranged from 0.136–0.667 and 0.543–0.877, respectively, while in a wild population it ranged from 0.000 to 0.895 and from 0.050 to 0.811, respectively. The development of these microsatellite markers will contribute to investigations of the reproductive potential and viability of introduced populations of D. distachya as well as the single known wild population. Cross-amplification in other Bromeliaceae species was successful, with high rates in four loci, demonstrating the applicability of these microsatellite markers in other taxa.

Highlights

Dyckia distachya Hassler is a rare, endemic bromeliad with a rupicolous, rheophytic habit that lives on riverbanks along the rapids of the Pelotas and UruguayRivers in southern Brazil [1]
Eight wild populations of D. distachya were known along the Uruguay and Pelotas
The transferability of these microsatellites will be helpful in conservation genetics studies in many bromeliad taxa

Summary

Introduction

Dyckia distachya Hassler is a rare, endemic bromeliad (subfamily Pitcairnioideae) with a rupicolous, rheophytic habit that lives on riverbanks along the rapids of the Pelotas and Uruguay. Eight wild populations of D. distachya were known along the Uruguay and Pelotas. Only one wild population is known, located in Salto do Yucumã in Turvo State Park, Derrubadas, Rio Grande do Sul State, which is on the border between Brazil and Argentina. During Barra Grande hydroelectric construction, some D. distachya populations were rescued and conserved ex situ. We report the isolation and characterization of a set of nine microsatellite loci for D. distachya in one introduced population and in the only one known wild population. The cross-amplification of these loci was examined in 22 related species from three subfamilies of Bromeliaceae. The transferability of these microsatellites will be helpful in conservation genetics studies in many bromeliad taxa

Results and Discussion

F: GGTGGAAATGGTGGGTTACA

Isolation of Microsatellite Markers

Primer Validation

Conclusions