MicroRNAs in Woody Plants.

Lisha Fang,Yanmei Wang

doi:10.3389/fpls.2021.686831

Abstract

MicroRNAs (miRNAs) are small (∼21-nucleotides) non-coding RNAs found in plant and animals. MiRNAs function as critical post-transcriptional regulators of gene expression by binding to complementary sequences in their target mRNAs, leading to mRNA destabilization and translational inhibition. Plant miRNAs have some distinct characteristics compared to their animal counterparts, including greater evolutionary conservation and unique miRNA processing methods. The lifecycle of a plant begins with embryogenesis and progresses through seed germination, vegetative growth, reproductive growth, flowering and fruiting, and finally senescence and death. MiRNAs participate in the transformation of plant growth and development and directly monitor progression of these processes and the expression of certain morphological characteristics by regulating transcription factor genes involved in cell growth and differentiation. In woody plants, a large and rapidly increasing number of miRNAs have been identified, but their biological functions are largely unknown. In this review, we summarize the progress of miRNA research in woody plants to date. In particular, we discuss the potential roles of these miRNAs in growth, development, and biotic and abiotic stresses responses in woody plants.

Highlights

MiRNAs are small (∼21-nucleotides) non-coding RNAs that have emerged as key post-transcriptional regulators of gene expression in both plants and animals (Jones-Rhoades et al, 2006; Chen, 2008; Filipowicz et al, 2008; Ramachandran and Chen, 2008)
The functions of miRNAs are affected by allelic variation; one single-nucleotide polymorphism (SNP) in the pre-miRNA region of Pto-MIR160a altered the number of loops in its secondary structure and was significantly associated with tree growth and wood properties (Tian et al, 2016)
Numerous conserved and species-specific miRNAs have been identified in many woody plants due to the advent of next-generation sequencing technologies

Summary

INTRODUCTION

MiRNAs are small (∼21-nucleotides) non-coding RNAs that have emerged as key post-transcriptional regulators of gene expression in both plants and animals (Jones-Rhoades et al, 2006; Chen, 2008; Filipowicz et al, 2008; Ramachandran and Chen, 2008). In the woody model plant P. trichocarpa, miR397 is the main regulator of lignin biosynthesis (Lu et al, 2013). These findings indicate that miR397 has a conserved role in the regulatory network of lignin biosynthesis in herbaceous and woody plants. Identifying and characterizing miRNAs in woody plants would greatly facilitate further research on the evolution and functions of miRNAs. According to the miRNA database (1, Release 22.1; Kozomara et al, 2019), among the 10,414 mature miRNAs identified in 82 plant species, 2,656 were from 26 tree species. Based on the identified miRNA families in plants and their sequence homology, cross-species comparisons have been performed to determine the conservation of certain miRNA families in different plant lineages (Jones-Rhoades, 2012). 22 highly conserved miRNAs families have been identified in plants, including miR156, miR159/miR319, miR160, miR162, miR164, 1http://www.mirbase.org 2http://www.pmiren.com/

References ucgcuuggugcaggucgggaa agcugcugagcuauggauccc

Findings

Conclusion and Future Perspectives