Abstract
We have determined the methylation status of the CpG island of the oestrogen receptor α gene in seven human ovarian cell lines. Cell lines expressing oestrogen receptor α showed no evidence of hypermethylation. In three of four cell lines that produced no detectable oestrogen receptor α protein, hypermethylation was observed at the NotI site of the CpG island. These results indicate that aberrant hypermethylation may be responsible for a significant proportion of epithelial ovarian tumours in which oestrogen receptor α expression is lost.British Journal of Cancer (2002) 86, 282–284. DOI: 10.1038/sj/bjc/6600028 www.bjcancer.com© 2002 The Cancer Research Campaign
Highlights
We have examined expression of oestrogen receptor a (ER-a) expression and methylation of the ERa CpG island in a series of human epithelial ovarian cell lines using the technique of methylation specific polymerase chain reaction (MS – PCR) (Herman et al, 1996)
The ovarian cell lines PEO14, A2780, OTN14 and OAW 42 were clearly negative for expression of ER-a protein
It would appear that DNA methylation of promoter sequences is associated with non-expression in three of the four ER-a negative epithelial ovarian cell lines
Summary
We have examined ER-a expression and methylation of the ERa CpG island in a series of human epithelial ovarian cell lines using the technique of methylation specific polymerase chain reaction (MS – PCR) (Herman et al, 1996). For methylated DNA the primers were 5’ ACGAGTTTAACGTCGCGGTC 3’ and 5’ ACCCCCCAAACCGTTAAAAC 3’ which gave a product of 110 bp (J Herman, private communication). RESULTS We analyzed the ER-a status of six epithelial ovarian cell lines by Western blotting.
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have