Macrolide resistant Mycoplasma pneumoniae in Auckland, New Zealand

Abstract

Mycoplasma pneumoniae is an important cause of community acquired pneumonia and other respiratory infections, particularly in school-aged children and young adults.1Waites K. Xiao L. Liu Y. Balish M. Atkinson T. Mycoplasma pneumoniae from the respiratory tract and beyond.Clin Microbiol Rev. 2017; 30: 747-808Crossref PubMed Scopus (252) Google Scholar Mycoplasma pneumoniae respiratory disease typically has a mild presentation, although severe and fatal cases also occur.1Waites K. Xiao L. Liu Y. Balish M. Atkinson T. Mycoplasma pneumoniae from the respiratory tract and beyond.Clin Microbiol Rev. 2017; 30: 747-808Crossref PubMed Scopus (252) Google Scholar It is a fastidious and slow growing organism, so the primary method for diagnosing acute infection is through nucleic acid amplification tests on respiratory specimens.1Waites K. Xiao L. Liu Y. Balish M. Atkinson T. Mycoplasma pneumoniae from the respiratory tract and beyond.Clin Microbiol Rev. 2017; 30: 747-808Crossref PubMed Scopus (252) Google Scholar Macrolide antimicrobials are typically the treatment of choice, having the greatest in vitro potency and the ability to be safely used in young children.1Waites K. Xiao L. Liu Y. Balish M. Atkinson T. Mycoplasma pneumoniae from the respiratory tract and beyond.Clin Microbiol Rev. 2017; 30: 747-808Crossref PubMed Scopus (252) Google Scholar,2Pereyre S. Goret J. Bebear C. Mycoplasma pneumoniae: current knowledge on macrolide resistance and treatment.Front Microbiol. 2016; 7: 974Crossref PubMed Scopus (134) Google Scholar However, treatment with macrolides has been complicated by the emergence of resistance, which occurs in association with mutations in the peptidyl-transferase loop of Mycoplasma 23S rRNA, primarily at positions 2063 and 2064.1Waites K. Xiao L. Liu Y. Balish M. Atkinson T. Mycoplasma pneumoniae from the respiratory tract and beyond.Clin Microbiol Rev. 2017; 30: 747-808Crossref PubMed Scopus (252) Google Scholar,2Pereyre S. Goret J. Bebear C. Mycoplasma pneumoniae: current knowledge on macrolide resistance and treatment.Front Microbiol. 2016; 7: 974Crossref PubMed Scopus (134) Google Scholar Worldwide, the prevalence of macrolide resistance displays significant geographic variation, with rates up to 90% in Asia, typically less than 10% in Europe, 7.5% in the United States (with substantial regional differences), while a study in South Australia detected no resistance.1Waites K. Xiao L. Liu Y. Balish M. Atkinson T. Mycoplasma pneumoniae from the respiratory tract and beyond.Clin Microbiol Rev. 2017; 30: 747-808Crossref PubMed Scopus (252) Google Scholar, 2Pereyre S. Goret J. Bebear C. Mycoplasma pneumoniae: current knowledge on macrolide resistance and treatment.Front Microbiol. 2016; 7: 974Crossref PubMed Scopus (134) Google Scholar, 3Smith S. Adamson P. Sadlon T. Gordan D. Prevalence of macrolide resistant Mycoplasma pneumoniae in South Australia.Pathology. 2016; 48: 639-642Abstract Full Text Full Text PDF PubMed Google Scholar, 4Waites K. Ratliff A. Crabb D. et al.Macrolide-Resistant Mycoplasma pneumoniae in the United States as determined from a national surveillance program.J Clin Microbiol. 2019; 57: 1-12Crossref Scopus (29) Google Scholar Current data suggest macrolide resistance is associated with a prolonged duration of fever and hospitalisation in children, although an increase in severe complications or mortality has not been described.1Waites K. Xiao L. Liu Y. Balish M. Atkinson T. Mycoplasma pneumoniae from the respiratory tract and beyond.Clin Microbiol Rev. 2017; 30: 747-808Crossref PubMed Scopus (252) Google Scholar,5Principi N. Esposito S. Macrolide resistance Mycoplasma pneumoniae: its role in respiratory infection.J Antimicrob Chemother. 2013; 68: 506-511Crossref PubMed Scopus (86) Google Scholar,6Chen Y. Hsu W. Chang T. Macrolide resistant Mycoplasma pneumoniae infections in pediatric community acquired pneumonia.Emerg Infect Dis. 2020; 26: 1382-1391Crossref PubMed Scopus (23) Google Scholar In New Zealand, macrolides are frequently used in the empiric antimicrobial treatment of community acquired pneumonia and for the specific treatment of M. pneumoniae. However, there has been an absence of local data on macrolide susceptibility. To help guide therapy and provide a baseline resistance estimate, this study determined the prevalence of macrolide resistance associated mutations in M. pneumoniae in the Auckland region of New Zealand.This was a retrospective descriptive study using stored DNA extracts from respiratory specimens that tested positive for M. pneumoniae using a real-time PCR assay, targeting an 89bp fragment of the repMp1 gene of M. pneumoniae, at the Auckland City Hospital laboratory, Auckland, New Zealand, between September 2016 and April 2020. Cases were identified from laboratory records and basic demographic and epidemiological data were extracted from electronic health records. Only cases from persons in the Auckland region were included. The presence of macrolide resistance associated mutations was assessed by PCR amplification of the peptidyl-transferase (domain V) region of the 23S rRNA gene using primers described by Wolff et al. (5′-3, forward AACTATAACGGTCCTAAGGTAGCG; reverse GCTCCTACCTATTCTCTACATGAT) followed by sequencing of the amplicon using an Applied Biosystems 3130x sequencer.7Wolff B. Thacker L. Schwartz S. Winchell J. Detection of macrolide resistance in Mycoplasma pneumoniae by real-time PCR and high-resolution melt analysis.Antimicrob Agents Chemother. 2008; 52: 3542-3549Crossref PubMed Scopus (136) Google Scholar Sequences were aligned against M. pneumoniae M129 reference genome (NCBI accession number NC_000912.1) using SeqMan II bioinformatic software (DNAStar, USA), with 23S rRNA mutations described using M. pneumoniae numbering. Study approval was obtained from the New Zealand Health and Disability Commission Ethics Committee (reference number 21/CEN/100). Funding was provided by the A+ Trust Microbiology Education and Research fund.Ninety M. pneumoniae cases from the Auckland region were identified for possible inclusion in this study. Seventy-nine of these cases had stored DNA extracts available for further testing; these included 39 from 2016–2018 and 40 from 2019–2020. These 79 cases had a median age of 22 years (range 0.5–92.5) and 42 (53%) were female. In 74 (94%) of the cases the specimen was collected in the inpatient or emergency department setting. Mutations in the 23S rRNA gene were detected in seven (9%) of 79 strains. All seven (100%) had the single-nucleotide polymorphism A2063G. One (3%) of 39 strains from 2016–2018 had a resistance associated mutation compared to six (15%) of 40 from 2019–2020. Four (57%) of the seven resistant strains were in persons ≤15 years of age. Six (86%) of the seven were in cases tested in the inpatient or emergency department setting.This study is the first to describe the occurrence of macrolide resistant M. pneumoniae in New Zealand, with the common resistance associated mutation A2063G identified in 9% of strains evaluated, comparable to rates of resistance that have been reported in Europe and the United States.1Waites K. Xiao L. Liu Y. Balish M. Atkinson T. Mycoplasma pneumoniae from the respiratory tract and beyond.Clin Microbiol Rev. 2017; 30: 747-808Crossref PubMed Scopus (252) Google Scholar,2Pereyre S. Goret J. Bebear C. Mycoplasma pneumoniae: current knowledge on macrolide resistance and treatment.Front Microbiol. 2016; 7: 974Crossref PubMed Scopus (134) Google Scholar,4Waites K. Ratliff A. Crabb D. et al.Macrolide-Resistant Mycoplasma pneumoniae in the United States as determined from a national surveillance program.J Clin Microbiol. 2019; 57: 1-12Crossref Scopus (29) Google Scholar As this study was geographically restricted to the Auckland region and consists primarily of hospitalised cases, the rate of resistance may not be generalisable across the country or to the infected population as a whole. Nevertheless, it illustrates the presence of macrolide resistant M. pneumoniae in New Zealand, the expanding global distribution of macrolide resistance, and the local need to consider the role of resistance and alternative antimicrobials in cases responding poorly to empiric macrolide therapy.Conflicts of interest and sources of fundingFunding was provided by the A+ Trust Microbiology Education and Research fund. The authors state that there are no conflicts of interest to disclose. Mycoplasma pneumoniae is an important cause of community acquired pneumonia and other respiratory infections, particularly in school-aged children and young adults.1Waites K. Xiao L. Liu Y. Balish M. Atkinson T. Mycoplasma pneumoniae from the respiratory tract and beyond.Clin Microbiol Rev. 2017; 30: 747-808Crossref PubMed Scopus (252) Google Scholar Mycoplasma pneumoniae respiratory disease typically has a mild presentation, although severe and fatal cases also occur.1Waites K. Xiao L. Liu Y. Balish M. Atkinson T. Mycoplasma pneumoniae from the respiratory tract and beyond.Clin Microbiol Rev. 2017; 30: 747-808Crossref PubMed Scopus (252) Google Scholar It is a fastidious and slow growing organism, so the primary method for diagnosing acute infection is through nucleic acid amplification tests on respiratory specimens.1Waites K. Xiao L. Liu Y. Balish M. Atkinson T. Mycoplasma pneumoniae from the respiratory tract and beyond.Clin Microbiol Rev. 2017; 30: 747-808Crossref PubMed Scopus (252) Google Scholar Macrolide antimicrobials are typically the treatment of choice, having the greatest in vitro potency and the ability to be safely used in young children.1Waites K. Xiao L. Liu Y. Balish M. Atkinson T. Mycoplasma pneumoniae from the respiratory tract and beyond.Clin Microbiol Rev. 2017; 30: 747-808Crossref PubMed Scopus (252) Google Scholar,2Pereyre S. Goret J. Bebear C. Mycoplasma pneumoniae: current knowledge on macrolide resistance and treatment.Front Microbiol. 2016; 7: 974Crossref PubMed Scopus (134) Google Scholar However, treatment with macrolides has been complicated by the emergence of resistance, which occurs in association with mutations in the peptidyl-transferase loop of Mycoplasma 23S rRNA, primarily at positions 2063 and 2064.1Waites K. Xiao L. Liu Y. Balish M. Atkinson T. Mycoplasma pneumoniae from the respiratory tract and beyond.Clin Microbiol Rev. 2017; 30: 747-808Crossref PubMed Scopus (252) Google Scholar,2Pereyre S. Goret J. Bebear C. Mycoplasma pneumoniae: current knowledge on macrolide resistance and treatment.Front Microbiol. 2016; 7: 974Crossref PubMed Scopus (134) Google Scholar Worldwide, the prevalence of macrolide resistance displays significant geographic variation, with rates up to 90% in Asia, typically less than 10% in Europe, 7.5% in the United States (with substantial regional differences), while a study in South Australia detected no resistance.1Waites K. Xiao L. Liu Y. Balish M. Atkinson T. Mycoplasma pneumoniae from the respiratory tract and beyond.Clin Microbiol Rev. 2017; 30: 747-808Crossref PubMed Scopus (252) Google Scholar, 2Pereyre S. Goret J. Bebear C. Mycoplasma pneumoniae: current knowledge on macrolide resistance and treatment.Front Microbiol. 2016; 7: 974Crossref PubMed Scopus (134) Google Scholar, 3Smith S. Adamson P. Sadlon T. Gordan D. Prevalence of macrolide resistant Mycoplasma pneumoniae in South Australia.Pathology. 2016; 48: 639-642Abstract Full Text Full Text PDF PubMed Google Scholar, 4Waites K. Ratliff A. Crabb D. et al.Macrolide-Resistant Mycoplasma pneumoniae in the United States as determined from a national surveillance program.J Clin Microbiol. 2019; 57: 1-12Crossref Scopus (29) Google Scholar Current data suggest macrolide resistance is associated with a prolonged duration of fever and hospitalisation in children, although an increase in severe complications or mortality has not been described.1Waites K. Xiao L. Liu Y. Balish M. Atkinson T. Mycoplasma pneumoniae from the respiratory tract and beyond.Clin Microbiol Rev. 2017; 30: 747-808Crossref PubMed Scopus (252) Google Scholar,5Principi N. Esposito S. Macrolide resistance Mycoplasma pneumoniae: its role in respiratory infection.J Antimicrob Chemother. 2013; 68: 506-511Crossref PubMed Scopus (86) Google Scholar,6Chen Y. Hsu W. Chang T. Macrolide resistant Mycoplasma pneumoniae infections in pediatric community acquired pneumonia.Emerg Infect Dis. 2020; 26: 1382-1391Crossref PubMed Scopus (23) Google Scholar In New Zealand, macrolides are frequently used in the empiric antimicrobial treatment of community acquired pneumonia and for the specific treatment of M. pneumoniae. However, there has been an absence of local data on macrolide susceptibility. To help guide therapy and provide a baseline resistance estimate, this study determined the prevalence of macrolide resistance associated mutations in M. pneumoniae in the Auckland region of New Zealand. This was a retrospective descriptive study using stored DNA extracts from respiratory specimens that tested positive for M. pneumoniae using a real-time PCR assay, targeting an 89bp fragment of the repMp1 gene of M. pneumoniae, at the Auckland City Hospital laboratory, Auckland, New Zealand, between September 2016 and April 2020. Cases were identified from laboratory records and basic demographic and epidemiological data were extracted from electronic health records. Only cases from persons in the Auckland region were included. The presence of macrolide resistance associated mutations was assessed by PCR amplification of the peptidyl-transferase (domain V) region of the 23S rRNA gene using primers described by Wolff et al. (5′-3, forward AACTATAACGGTCCTAAGGTAGCG; reverse GCTCCTACCTATTCTCTACATGAT) followed by sequencing of the amplicon using an Applied Biosystems 3130x sequencer.7Wolff B. Thacker L. Schwartz S. Winchell J. Detection of macrolide resistance in Mycoplasma pneumoniae by real-time PCR and high-resolution melt analysis.Antimicrob Agents Chemother. 2008; 52: 3542-3549Crossref PubMed Scopus (136) Google Scholar Sequences were aligned against M. pneumoniae M129 reference genome (NCBI accession number NC_000912.1) using SeqMan II bioinformatic software (DNAStar, USA), with 23S rRNA mutations described using M. pneumoniae numbering. Study approval was obtained from the New Zealand Health and Disability Commission Ethics Committee (reference number 21/CEN/100). Funding was provided by the A+ Trust Microbiology Education and Research fund. Ninety M. pneumoniae cases from the Auckland region were identified for possible inclusion in this study. Seventy-nine of these cases had stored DNA extracts available for further testing; these included 39 from 2016–2018 and 40 from 2019–2020. These 79 cases had a median age of 22 years (range 0.5–92.5) and 42 (53%) were female. In 74 (94%) of the cases the specimen was collected in the inpatient or emergency department setting. Mutations in the 23S rRNA gene were detected in seven (9%) of 79 strains. All seven (100%) had the single-nucleotide polymorphism A2063G. One (3%) of 39 strains from 2016–2018 had a resistance associated mutation compared to six (15%) of 40 from 2019–2020. Four (57%) of the seven resistant strains were in persons ≤15 years of age. Six (86%) of the seven were in cases tested in the inpatient or emergency department setting. This study is the first to describe the occurrence of macrolide resistant M. pneumoniae in New Zealand, with the common resistance associated mutation A2063G identified in 9% of strains evaluated, comparable to rates of resistance that have been reported in Europe and the United States.1Waites K. Xiao L. Liu Y. Balish M. Atkinson T. Mycoplasma pneumoniae from the respiratory tract and beyond.Clin Microbiol Rev. 2017; 30: 747-808Crossref PubMed Scopus (252) Google Scholar,2Pereyre S. Goret J. Bebear C. Mycoplasma pneumoniae: current knowledge on macrolide resistance and treatment.Front Microbiol. 2016; 7: 974Crossref PubMed Scopus (134) Google Scholar,4Waites K. Ratliff A. Crabb D. et al.Macrolide-Resistant Mycoplasma pneumoniae in the United States as determined from a national surveillance program.J Clin Microbiol. 2019; 57: 1-12Crossref Scopus (29) Google Scholar As this study was geographically restricted to the Auckland region and consists primarily of hospitalised cases, the rate of resistance may not be generalisable across the country or to the infected population as a whole. Nevertheless, it illustrates the presence of macrolide resistant M. pneumoniae in New Zealand, the expanding global distribution of macrolide resistance, and the local need to consider the role of resistance and alternative antimicrobials in cases responding poorly to empiric macrolide therapy. Conflicts of interest and sources of fundingFunding was provided by the A+ Trust Microbiology Education and Research fund. The authors state that there are no conflicts of interest to disclose.