Abstract
LR4 gene expression in patients with chronic suppurative otitis media
Highlights
Otitis media (OM) is a group of complex infectious and inflammatory disease that affects the middle ear cavity
Consistent with the above view, down-regu lation of the Toll-Like Receptor 4 (TLR4) gene has been reported in the middle ear epithelia of Chronic suppurative otitis media (CSOM) patients [10]
The case group comprised of CSOM patients (n = 16) and the control group comprised of age and gender-matched healthy controls (n = 16)
Summary
Inclusion criteria for the cases were (i) patients diagnosed with CSOM (ii) both genders in the age group of 18-60 years. One ml of whole blood samples of both CSOM patients and healthy controls were collected in an EDTA vacutainer and used for quantification of TLR4 gene expression. The TLR4 gene expression was performed by using quantitative reverse transcription polymerase chain reaction (qRT-PCR) CFX96 touch system (Bio-Rad, USA). Total RNA samples were converted to cDNA using iScript cDNA conversion kit (Bio-Rad, USA). Real-time quantification of TLR4 and GAPDH genes were performed using SYBR green method (Bio-Rad, USA). Following primers were used to quantify the expression of TLR4 and GAPDH (Sigma, USA): TLR4 gene: Forward primer: 5′ GAACCTGGACCTGAGCTTTAAT 3′ Reverse primer: 5′ GTCTGGATTTCACACCTGGATAA 3′. P-value less than 0.05 were considered to be statistically significant
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
