Abstract

Insulin-like growth factor II (IGF2) is maternally imprinted in most tissues, but the epigenetic regulation of the gene in cancer stem cells (CSCs) has not been defined. To study the epigenetic mechanisms underlying self-renewal, we isolated CSCs and non-CSCs from colon cancer (HT29, HRT18, HCT116), hepatoma (Hep3B), breast cancer (MCF7) and prostate cancer (ASPC) cell lines. In HT29 and HRT18 cells that show loss of IGF2 imprinting (LOI), IGF2 was biallelically expressed in the isolated CSCs. Surprisingly, we also found loss of IGF2 imprinting in CSCs derived from cell lines HCT116 and ASPC that overall demonstrate maintenance of IGF2 imprinting. Using chromatin conformation capture (3C), we found that intrachromosomal looping between the IGF2 promoters and the imprinting control region (ICR) was abrogated in CSCs, in parallel with loss of IGF2 imprinting in these CSCs. Loss of imprinting led to increased IGF2 expression in CSCs, which have a higher rate of colony formation and greater resistance to chemotherapy and radiotherapy in vitro. These studies demonstrate that IGF2 LOI is a common feature in CSCs, even when the stem cells are derived from a cell line in which the general population of cells maintain IGF2 imprinting. This finding suggests that aberrant IGF2 imprinting may be an intrinsic epigenetic control mechanism that enhances stemness, self-renewal and chemo/radiotherapy resistance in cancer stem cells.

Highlights

  • Loss of insulin-like growth factor II imprinting is a hallmark associated with enhanced chemo/radiotherapy resistance in cancer stem cells

  • CACTGAGTCATCTCAAAGTTAAGC ccttcaagcacactgcacactcc ctcct ggtggggcgc tgggagc tgcctgcccggagaccccagctc tccttgatacaacagctgacctca ccgaaaagtacaacatctggcc cGGCCAATCAGAGCAGGGCCCTC GCCCACCTCCGCCCTGGACAGT CACCCCCTCCCTCACCCTGCTCCT CTAGCCCGGGCTTTTTCTAACTG

Read more

Summary

Introduction

Loss of insulin-like growth factor II imprinting is a hallmark associated with enhanced chemo/radiotherapy resistance in cancer stem cells

Results
Conclusion
Full Text
Published version (Free)

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call