Abstract

BackgroundThe mechanisms of bone fragility in type 1 diabetes (T1D) are not fully understood. Whether glucagon-like peptide-1 receptor (GLP-1R) agonists could improve bone quality in T1D context also remains elusive.AimsWe aimed to explore the possible mechanisms of bone loss in T1D and clarify whether liraglutide has effects on bone quality of T1D mice using transcriptomics.MethodsFemale streptozotocin-induced diabetic C57BL/6J mice were randomly divided into four groups and received the following treatments daily for 8 weeks: saline as controls, insulin, liraglutide, and liraglutide combined with insulin. These groups were also compared with non-STZ-treated normal glucose tolerance (NGT) group. Trunk blood and bone tissues were collected for analysis. Three tibia from each of the NGT, saline-treated, and liraglutide-treated groups were randomly selected for transcriptomics.ResultsCompared with NGT mice, saline-treated T1D mice manifested markedly hyperglycemia and weight loss, and micro-CT revealed significantly lower bone mineral density (BMD) and deficient microarchitectures in tibias. Eight weeks of treatment with liraglutide alone or combined with insulin rescued the decreased BMD and partly corrected the compromised trabecular microarchitectures. Transcriptomics analysis showed there were 789 differentially expressed genes mainly mapped to osteoclastogenesis and inflammation pathways. The RT-qPCR verified that the gene expression of Trem2, Nfatc1, Trap, and Ctsk were significantly increased in the tibia of T1D compared with those in the NGT group. Liraglutide treatment alone or combined with insulin could effectively suppress osteoclastogenesis by downregulating the gene expression of Trem2, Nfatc1, Ctsk, and Trap.ConclusionsTaken together, increased osteoclastogenesis with upregulated expression of Trem2 played an important role in bone loss of T1D mice. Liraglutide provided protective effects on bone loss in T1D mice by suppressing osteoclastogenesis.

Highlights

  • Type 1 diabetes (T1D) is characterized by autoimmune destruction of pancreatic islet b cells leading to severe hyperglycemia [1]

  • Saline-treated T1D mice manifested markedly hyperglycemia and weight loss when compared with normal glucose tolerance (NGT)

  • Liraglutide monotherapy significantly improved glucose control especially in the second half of the experiment compared with the salinetreated T1D group and insulin treatment group but did not restore weight loss, probably because liraglutide partly restored b-cell function and had weight loss effect (Figure 1 and Supplementary Tables 2, 3)

Read more

Summary

Background

The mechanisms of bone fragility in type 1 diabetes (T1D) are not fully understood. Whether glucagon-like peptide-1 receptor (GLP-1R) agonists could improve bone quality in T1D context remains elusive. Aims: We aimed to explore the possible mechanisms of bone loss in T1D and clarify whether liraglutide has effects on bone quality of T1D mice using transcriptomics

Methods
Results
Conclusions
INTRODUCTION
F: GAGATTACTGCTCTGGCTCCTA R: GGACTCATCGTACTCCTGCTTG F
DISCUSSION
CONCLUSION
ETHICS STATEMENT

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call

Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.