Links between S-adenosylmethionine and Agr-based quorum sensing for biofilm development in Listeria monocytogenes EGD-e.

Chinling Wang,Yue‐Jia Lee

doi:10.1002/mbo3.1015

Abstract

Listeria monocytogenes is the causative agent of human listeriosis which has high hospitalization and mortality rates for individuals with weakened immune systems. The survival and dissemination of L. monocytogenes in adverse environments can be reinforced by the formation of biofilms. Therefore, this study aimed to understand the mechanisms underlying listerial biofilm development. Given that both nutrient availability and quorum sensing (QS) have been known as the factors influencing biofilm development, we hypothesized that the signal from a sentinel metabolite S‐adenosylmethionine (SAM) and Agr‐based QS could be synchronous in L. monocytogenes to modulate nutrient availability, the synthesis of extracellular polymeric substances (EPSs), and biofilm formation. We performed biofilm assays and quantitative real‐time PCR to investigate how biofilm volumes and the expression of genes for the synthesis of EPS were affected by SAM supplementation, agr deletion, or both. We found that exogenously applied SAM induced biofilm formation and that the expression of genes encoding the EPS synthesis machineries was regulated by SAM and/or Agr QS. Moreover, the gene transcription of components acting in the methyl cycle for SAM synthesis and Agr QS was affected by the signals from the other system. In summary, we reveal an interconnection at the transcriptional level between metabolism and QS in L. monocytogenes and highlight the critical role of metabolite‐oriented QS in biofilm development.

Highlights

As an environmental pathogen, Listeria monocytogenes replicates and survives in both the environment and within mammalian hosts (Xayarath & Freitag, 2012)
Of three tested genes for peptidoglycan synthesis, the expression of pbpA1 was significantly repressed in sessile ΔagrA and ΔagrD cells compared with sessile WT cells, while the expression of murA and murE stayed at similar levels among WT and two mutants (Figure 5a)
The persistence of L. monocytogenes and the recurrent cross-contamination of food products are largely attributed to the formation of biofilms on hard-to-clean harborage and the protection from biofilms against environmental stresses (Holch et al, 2013; Lunden, Autio, Markkula, Hellstrom, & Korkeala, 2003)

Summary

| INTRODUCTION

Wolfaardt, Ingham, & Caldwell, 1997; Poimenidou et al, 2009). Within biofilms, the bacteria are enclosed in self-produced extracellular polymeric substances (EPSs), enabling them to sense and adapt to diverse environments (Hall-Stoodley, Costerton, & Stoodley, 2004). Both Gram-positive and Gram-negative bacteria conserve a three-stage mechanism of peptidoglycan synthesis This process (Figure 1a) begins in the cytoplasm with the conversion of saccharide units (from UDP-N-acetylglucosamine [UDP-GlcNAc] to UDPN-acetylmuramic acid [UDP-MurNAc]) and the addition of peptide bridges by proteins encoded by mur genes (murA-F). Transcriptomic studies recently verified that biofilms comprise heterogeneous populations of bacteria with differences in replication rates and gene regulation between the sessile and planktonic cells (Hamilton et al, 2009; Lazazzera, 2005; Luo et al, 2013). This suggests that the bacterial population takes the advantage of the heterogeneous nature of the biofilm to survive under environmental stresses. Our results indicated that the manipulated objects in this mutual regulation were dependent on the transition from the planktonic to sessile life mode

| MATERIALS AND METHODS

F: GTAGTTTCAGCTTCTATTACGCTTGTG R: ATACCAACAAATTCGCCAACATTCC F

F: GAGGGTCATTGGAAACTGGAAGAC R

| DISCUSSION