LANCL2 Is Necessary for Abscisic Acid Binding and Signaling in Human Granulocytes and in Rat Insulinoma Cells

Laura Sturla,Chiara Fresia,Lucrezia Guida,Santina Bruzzone,Sonia Scarfì,Cesare Usai,Floriana Fruscione,Mirko Magnone,Enrico Millo,Giovanna Basile,Alessia Grozio,Emanuela Jacchetti,Marcello Allegretti,Antonio De Flora,Elena Zocchi

doi:10.1074/jbc.m109.035329

Abstract

Abscisic acid (ABA) is a plant hormone regulating fundamental physiological functions in plants, such as response to abiotic stress. Recently, ABA was shown to be produced and released by human granulocytes, by insulin-producing rat insulinoma cells, and by human and murine pancreatic beta cells. ABA autocrinally stimulates the functional activities specific for each cell type through a receptor-operated signal transduction pathway, sequentially involving a pertussis toxin-sensitive receptor/G-protein complex, cAMP, CD38-produced cADP-ribose and intracellular calcium. Here we show that the lanthionine synthetase C-like protein LANCL2 is required for ABA binding on the membrane of human granulocytes and that LANCL2 is necessary for transduction of the ABA signal into the cell-specific functional responses in granulocytes and in rat insulinoma cells. Co-expression of LANCL2 and CD38 in the human HeLa cell line reproduces the ABA-signaling pathway. Results obtained with granulocytes and CD38(+)/LANCL2(+) HeLa transfected with a chimeric G-protein (G alpha(q/i)) suggest that the pertussis toxin-sensitive G-protein coupled to LANCL2 is a G(i). Identification of LANCL2 as a critical component of the ABA-sensing protein complex will enable the screening of synthetic ABA antagonists as prospective new anti-inflammatory and anti-diabetic agents.

Highlights

The plant hormone abscisic acid (ABA)4 plays a fundamental role in the regulation of plant response to environmental con
CD38ϩ HeLa—Pre-treatment with pertussis toxin (PTX) abrogated the [cAMP]i increase triggered by ABA in LANCL2ϩ/CD38ϩ HeLa (Fig. 5C), to what already observed in human granulocytes [16] and in human and rat insulin-releasing cells [19]
The following lines of evidence support the conclusion that LANCL2 is necessary for ABA binding and signaling in mammalian cells: (i) silencing of LANCL2 abrogates the ABA-induced increase of the [Ca2ϩ]i and of the [cAMP]i in human granulocytes (Fig. 1) and prevents the ABA-triggered stimulation of cell migration, reactive oxygen species (ROS) production, and phagocytosis (Fig. 2); (ii) LANCL2 overexpression potentiates the [Ca2ϩ]i increase induced by ABA in granulocytes (Fig. 1D) and confers ABA responsiveness (i.e. [Ca2ϩ]i and [cAMP]i increase, Fig. 5) to CD38ϩ HeLa; and (iii), LANCL2 silencing abrogates the ABA-induced biochemical

Summary

EXPERIMENTAL PROCEDURES

Materials—Fura2/AM was purchased from Calbiochem (Milan, Italy). The [3H]cAMP assay system, Ficoll-Paque Plus and [3H](Ϯ)-ABA (40 Ci/mmol) were from Amersham Biosciences. CD38ϩ and CD38Ϫ HeLa transfected with the control or with the LANCL2 plasmid were seeded on 20-mm glass coverslips, and [Ca2ϩ]i determinations were performed after 24 h, as described in a previous study [25]. For measurement of the [cAMP]i in CD38ϩ/LANCL2ϩ HeLa, cells (1.5 ϫ 106/determination in a total volume of 0.7 ml of HBSS) were preincubated for 10 min at 25 °C with 10 ␮M Ro 20-1724, the supernatant was removed, and 0.7 ml of HBSS with or without 100 nM ABA was added; after 0.5 and 1 min the incubation was stopped with PCA (0.6 M final concentration). Granulocytes, CD38ϩ, and CD38ϩ/LANCL2ϩ HeLa cells were transfected with pCS2ϩ/␣-transducin or with pcDNAI/G␣q/i plasmids. Twenty-four hours after transfection with the plasmid, granulocytes and HeLa were washed

ATGATTCTACCCACGGCAAG CTGGAAGATGGTGATGGGTT

RESULTS

Findings

DISCUSSION