Abstract
Specificity of RNAi to selected target is challenged by off-target effects, both canonical and non-canonical. Notably, more than half of all human microRNAs are co-expressed with hosting them proteincoding genes. Here we dissect regulatory subnetwork centered on IGFBP6 gene, which is associated with low proliferative state and high migratory activity of basal-like breast cancer. We inhibited expression of IGFBP6 gene in a model cell line for basal-like breast carcinoma MDA-MB-231, then traced secondary and tertiary effects of this knockdown to LAMA4, a laminin encoding gene that contributes to the phenotype of triple-negative breast cancer. LAMA4-regulating miRNA miR-4274 and its host gene SORCS2 were highlighted as intermediate regulators of the expression levels of LAMA4, which correlated in a basal-like breast carcinoma sample subset of TCGA to the levels of SORCS2 negatively. Overall, our study points that the secondary and tertiary layers of regulatory interactions are certainly underappreciated. As these types of molecular event may significantly contribute to the formation of the cell phenotypes after RNA interference based knockdowns, further studies of multilayered molecular networks affected by RNAi are warranted.
Highlights
MicroRNAs constitute one of the largest families of non-coding RNAs and are known to regulate the proliferative and migratory activity of tumor cells (Makarova et al, 2015)
For RNA interference (RNAi)-mediated knockdown of the IGFBP6 gene, the MDA-MB-231 cells were transduced with lentiviral expression vector pLVX-shRNA1 (Clontech Laboratories, USA) carrying the following shRNAencoding sequence: 5′-gatccGCCCAATTGTGACCATCGA TCGATTCAAGAGATCGATCGTCACAATGGGGCTTTTTTT
Transcriptional knockdown of IGFBP6 gene in MDA-MB231 cells resulted in inhibition of cell migration with concomitant increase in the rate of proliferation (Nikulin et al, 2018)
Summary
MicroRNAs constitute one of the largest families of non-coding RNAs and are known to regulate the proliferative and migratory activity of tumor cells (Makarova et al, 2015). According to the current estimates, microRNAs regulate expression of more than 60% of protein-coding genes (Makarova et al, 2016). An increase in levels of certain microRNA may lead to a decrease in mRNA levels of their target genes and vice versa. This may lead to significant alterations of cell phenotypes (Galatenko et al, 2018a). MicroRNA encoding genes may be arranged as independent transcription units and within the introns and exons of both protein-coding and non-coding RNA genes (Makarova et al, 2016). We have demonstrated the regulatory interactions between the protein-coding genes which host certain miRNAs and the protein-coding target genes of these miRNA (Galatenko et al, 2018a)
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
