Lack of association between two polymorphisms in the corticotropin-releasing hormone gene promoter and preterm birth in a Hispanic population

Abstract

The molecular mechanisms involved in the initiation of preterm labor are still unknown. Several studies have shown that corticotropin-releasing hormone (CRH) is one of the main molecules related to the onset of preterm labor. CRH is a hypothalamic hormone that is also synthesized by the placenta and fetal membranes during the third trimester of pregnancy. Changes in CRH concentration in late pregnancy, both term and preterm, seem to depend on ethnicity, since Hispanic women have a higher plasma concentration of this hormone at 30 weeks of pregnancy compared with black or nonHispanic women. Furthermore, concentrations of CRH in white women with preterm labor are higher compared with black women with preterm labor [1]. These ethnic variations can be partly explained by differences in genetic background, such as the presence of polymorphisms in the CRH gene. The CRH gene promoter has 4 polymorphisms that have been designated: T-3371G, C-3531G, T-2353C, and T-684C. Three of these polymorphisms (C-3531G, T-2353C, T-684C) cosegregated completely resulting in 2 alleles: A1 and A2. Including the fourth polymorphism in the CRH promoter (T-3371G), the combined alleles have been designated as A1B1, A1B2, A2B1, and A2B2 [2]. The association of these polymorphisms with diseases and their molecular and biological functions have been reported. Populationbased studies have shown that the A2B1 compound allele is protective for the development of rheumatoid arthritis; meanwhile, the A1B1 allele is associated with the development of rheumatoid arthritis [3]. Moreover, in vitro studies using cells transiently transfected with the combined haplotype of the CRH gene promoter coupled to a reporter gene have shown differences in transcriptional activity [4]. It was hypothesized that polymorphisms in the CRH promoter influence the expression of this hormone in pregnant women, and thus might play a role in the induction of preterm birth. The aim of the present studywas to assess the association of CRH polymorphisms with spontaneous preterm birth in a Hispanic population. Patients included in the study were Hispanic women who were receiving obstetric care at the UMAE HGO4 “Luis Castelazo Ayala”, Mexico City, Mexico, between September 2006 and December 2007. The Institutional Review Board and the research ethics committee approved the protocol for sample collection. All study participants gave written informed consent before sample collection. All included pregnancies in this study were singleton live births. Gestational age was determined by last menstrual period and corroborated by ultrasound dating. The control group (n=55) comprised women with normal term deliveries without complications related to pregnancy. The case group comprised women with preterm birth (n=65), defined as preterm delivery preceded by spontaneous labor. Genomic DNA was extracted from placental samples using the QIAamp DNAMini Kit (Qiagen, Valencia, CA, USA), according to themanufacturer's instructions. Polymorphisms in the CRH promoter were analyzed by PCR-RFLP technique, as previously described [5]. Primers used to analyze the CRH promoter polymorphisms in this study were: CRHA: forward 5′ GCTGTTCTTGTGATAGTAAATA 3′, reverse 5′ CCC CAGAGGAAGAGAAGC 3′; CRHB: forward 5′ TGAAGGTACAAGGTGATACAAGTG ACAA 3′, reverse 5′ ACACAAACTGAGGTGAAAAGATGAA 3′. Statistical analysis was performed with Stata SE, version 11.0 (Stata Corp., College Station, TX, USA). The haplotype analysis was performed using the web tool SNPstats. Pb0.05 was considered statistically significant. The demographic characteristics of the 2 groups are shown in Table 1. As expected, the estimated gestational age on admission and neonatal birth weight were significantly different between the preterm and term groups. Distribution of both polymorphisms in the population was consistent with Hardy-Weinberg equilibrium. The frequencies of CRH-A and -B were in accordance with previously published data in other populations. No differences in genotype and allele frequencies for CRH-A and -B were observed between the 2 groups (Table 2). Furthermore, haplotype analysis for both polymorphisms did not reveal significant differences between preterm and term groups (data not shown). This study compared the presence of 2 polymorphisms located in the promoter of the CRH gene in a Hispanic population that had normal term or preterm delivery. The results showed that there was no association between the presence of these polymorphisms and spontaneous preterm birth in this population. However, study of the