Laboratory Testing Methods for Novel Severe Acute Respiratory Syndrome-Coronavirus-2 (SARS-CoV-2).

Roshan J D'Cruz,Arthur W Currier,Valerie B Sampson

doi:10.3389/fcell.2020.00468

Abstract

Following the first reports of coronavirus disease-19 (COVID-19) by China to the World Health Organization (WHO) on 31st December 2019, more than 4,302,774 novel severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) cases have been reported by authorities in 212 countries and territories by 12th May 2020. The outbreak and spread of COVID-19 worldwide, highlights the critical need for developing rapid and accurate diagnostic testing methods for emerging human coronavirus (CoV) infections. Testing is crucial to track the spread of disease during a pandemic, and to swiftly permit public health interventions including isolation, quarantine, and appropriate clinical management of afflicted individuals. The key components of viral diagnostic tests are (1) collection of the appropriate sample (blood, nasal swab, and throat swab), (2) availability of the genetic and proteomic sequences of the novel virus for analysis, and (3) rapid and accurate laboratory testing methods. The current gold standard for the molecular diagnosis of SARS-CoV-2 infection is the real-time reverse transcriptase-polymerase chain reaction (RT-PCR) for the qualitative and quantitative detection of viral nucleic acids. Other relevant laboratory methods include enzyme-linked immunoassays (EIA) for viral antibody and antigen detection, and serum viral neutralization (SVN) assays for antibody neutralization determination. The challenges faced in developing a diagnostic test for a novel pathogen are the ability to measure low viral loads for early detection, to provide low or no cross-reactivity with other viral strains and to deliver results rapidly. Several point-of-care molecular devices are currently being integrated for fast and accurate diagnosis of SARS-CoV-2 infections. This review discusses the current laboratory methods available to test for coronaviruses by focusing on the present COVID-19 outbreak.

Highlights

Coronavirus disease-19 (COVID-19) is caused by a novel coronavirus (CoV) that was originally reported in Wuhan, Hubei province, China in December 2019 (World Health Organization, 2020a)
This novel CoV has been identified as the seventh CoV that is transmissible between humans (Salata et al, 2019)
This review describes the available testing methods for SARS-CoV-2 and brings to light the importance of laboratory testing to control this disease and prepare for possible future disease threats

Summary

INTRODUCTION

Coronavirus disease-19 (COVID-19) is caused by a novel coronavirus (CoV) that was originally reported in Wuhan, Hubei province, China in December 2019 (World Health Organization, 2020a). The use of multiplex assays is potentially beneficial as this can improve sensitivity in cases of loss or degradation of viral RNA during specimen collection and nucleic acid extraction, or in the event of mutation of the virus genome. These assays use in vitro synthesized RNA derived from transcripts (e.g., BetaCoV_Wuhan_WIV04_2019, GISAID Access number: EPI_ISL_402124) as positive controls and to generate standard curves. False positive results could be generated by cross-reactivity of primers with nucleic acids arising from co-infection with other viruses or bacteria In these cases, the agent detected may not be the definite cause of disease.

F: CCCTGTGGGTTTTACACTTAA R: ACGATTGTGCATCAGCTGA P

Emerging Methods

CONCLUSION