Juvenile Hormone Regulates Vitellogenin Gene Expression through Insulin-like Peptide Signaling Pathway in the Red Flour Beetle, Tribolium castaneum

Zhentao Sheng,Jingjing Xu,Hua Bai,Fang Zhu,Subba R Palli

doi:10.1074/jbc.m111.269845

Abstract

Our recent studies identified juvenile hormone (JH) and nutrition as the two key signals that regulate vitellogenin (Vg) gene expression in the red flour beetle, Tribolium castaneum. Juvenile hormone regulation of Vg synthesis has been known for a long time in several insects, but the mechanism of JH action is not known. Experiments were conducted to determine the mechanism of action of these two signals in regulation of Vg gene expression. Injection of bovine insulin or FOXO double-stranded RNA into the previtellogenic, starved, or JH-deficient female adults increased Vg mRNA and protein levels, thereby implicating the pivotal role for insulin-like peptide signaling in the regulation of Vg gene expression and possible cross-talk between JH and insulin-like peptide signaling pathways. Reduction in JH synthesis or its action by RNAi-mediated silencing of genes coding for acid methyltransferase or methoprene-tolerant decreased expression of genes coding for insulin-like peptides (ILPs) and influenced FOXO subcellular localization, resulting in the down-regulation of Vg gene expression. Furthermore, JH application to previtellogenic female beetles induced the expression of genes coding for ILP2 and ILP3, and induced Vg gene expression. FOXO protein expressed in baculovirus system binds to FOXO response element present in the Vg gene promoter. These data suggest that JH functions through insulin-like peptide signaling pathway to regulate Vg gene expression.

Highlights

Juvenile hormone (JH) and nutrition signals regulate vitellogenin (Vg) synthesis in insects
In this study we show that both nutrition and JH are necessary for vitellogenesis, and both these signals work through the insulin-like peptide pathway and the downstream FOXO transcription factor to regulate Vg synthesis
To determine whether the JH influence on insulin-like peptide pathway is through regulation of synthesis of insulin-like peptides (ILPs), the mRNA levels of ILPs were quantified in the fat body and brain dissected from adult female beetles injected with control malE, JH Acid Methyl Transferase (JHAMT), or Met double-stranded RNA (dsRNA)

Summary

Background

Juvenile hormone (JH) and nutrition signals regulate vitellogenin (Vg) synthesis in insects. TTACGTCTGGTCTTCACCGCACAT TGGTTGGGTTTGGATTCGGAGAGT TGGCCGGAATACACACTTGTAGGA TCTTCTTCCGCAGTAGACCGCTTT AAAGTCTGCTTCACCTTGCTCCTC AATAGCGCACAGTTCGGTGAGAGT TCGGAGAAGCGACCAAAGCTACAA TCTGAAGTGATAGAAGCGCCAGCA CAACGAAGAGGGCAACAAGT CGCACTGATTTTCCTGGTTT CGACTTCACCAAGTGCAAAA GCCCCCTCATTGTAAACGTA obviated with JH treatment [17] Taken together, these studies suggest that vitellogenesis in insects is regulated by the nutrient-sensing insulin-like peptide/TOR pathways, but the crosstalk between JH and nutrient signals involved in regulation of vitellogenesis remains unclear. These studies suggest that vitellogenesis in insects is regulated by the nutrient-sensing insulin-like peptide/TOR pathways, but the crosstalk between JH and nutrient signals involved in regulation of vitellogenesis remains unclear To address this long-standing question, we used the red flour beetle, Tribolium castaneum, as our model system because of the availability of whole genome sequence and well functioning systemic RNAi [18]. In this study we show that both nutrition and JH are necessary for vitellogenesis, and both these signals work through the insulin-like peptide pathway and the downstream FOXO transcription factor to regulate Vg synthesis

EXPERIMENTAL PROCEDURES

RESULTS

DISCUSSION