Abstract
Tissue remodeling is a crucial process in animal development and disease progression. Coordinately controlled by the two main insect hormones, juvenile hormone (JH) and 20-hydroxyecdysone (20E), tissues are remodeled context-specifically during insect metamorphosis. We previously discovered that two matrix metalloproteinases (Mmps) cooperatively induce fat body cell dissociation in Drosophila However, the molecular events involved in this Mmp-mediated dissociation are unclear. Here we report that JH and 20E coordinately and precisely control the developmental timing of Mmp-induced fat body cell dissociation. We found that during the larval-prepupal transition, the anti-metamorphic factor Kr-h1 transduces JH signaling, which directly inhibited Mmp expression and activated expression of tissue inhibitor of metalloproteinases (timp) and thereby suppressed Mmp-induced fat body cell dissociation. We also noted that upon a decline in the JH titer, a prepupal peak of 20E suppresses Mmp-induced fat body cell dissociation through the 20E primary-response genes, E75 and Blimp-1, which inhibited expression of the nuclear receptor and competence factor βftz-F1 Moreover, upon a decline in the 20E titer, βftz-F1 expression was induced by the 20E early-late response gene DHR3, and then βftz-F1 directly activated Mmp expression and inhibited timp expression, causing Mmp-induced fat body cell dissociation during 6-12 h after puparium formation. In conclusion, coordinated signaling via JH and 20E finely tunes the developmental timing of Mmp-induced fat body cell dissociation. Our findings shed critical light on hormonal regulation of insect metamorphosis.
Highlights
Tissue remodeling is a crucial process in animal development and disease progression
We examined whether juvenile hormone (JH) signaling prevents fat body cell dissociation by regulating matrix metalloproteinases (Mmps) expression
We performed a Western blot analysis [2], and detected increased protein levels for both Mmps at 6 h after puparium formation (APF) in the fat body of animals lacking JH signaling, including Aug21Gal4 Ͼ UAS-grim, Met27gce2.5k, and Kr-h1k04411, whereas protein levels decreased at 12 h APF in the fat body of the Kr-h1– overexpressing animals, Lsp2-GAL4 Ͼ UAS-Kr-h1 (Fig. 1B)
Summary
The developmental timing of fat body cell dissociation is strictly controlled in Drosophila and occurs only within a small window immediately before pupation, from 6 h APF to 12 h APF [1, 2]. One copy of the sequence produced an inhibitory response similar to the Ϫ1473 to Ϫ1308 fragment, whereas four copies of the sequence resulted in luciferase activity that was reduced by half compared with that with EGFP overexpression (Fig. 2C), suggesting the sequence CTCAATAACCTATGCCACAT in the Mmp promoter is a KBS. When JH titer declines, the prepupal peak of 20E suppresses Mmp–induced fat body cell dissociation through the 20E primary-response genes, E75 and Blimp-1, which inhibit ftz-F1 expression indirectly or directly. Until 20E titer declines, ftz-F1 expression is induced by the 20E early–late response gene DHR3; ftz-F1 directly activates Mmp expression and causes Mmp–induced fat body cell dissociation occurring from 6 h APF to 12 h APF. JH and 20E coordinately and precisely control Mmps activity at both mRNA and enzymatic levels so that fat body cell dissociation occurs within 6 h before pupation (Fig. 7)
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
