JNK1-dependent PUMA Expression Contributes to Hepatocyte Lipoapoptosis

Sophie C Cazanave,Justin L Mott,Nafisa A Elmi,Steven F Bronk,Nathan W Werneburg,Yuko Akazawa,Alisan Kahraman,Sean P Garrison,Gerard P Zambetti,Michael R Charlton,Gregory J Gores

doi:10.1074/jbc.m109.022491

Abstract

Free fatty acids (FFA) induce hepatocyte lipoapoptosis by a c-Jun N-terminal kinase (JNK)-dependent mechanism. However, the cellular processes by which JNK engages the core apoptotic machinery during lipotoxicity, especially activation of BH3-only proteins, remain incompletely understood. Thus, our aim was to determine whether JNK mediates induction of BH3-only proteins during hepatocyte lipoapoptosis. The saturated FFA palmitate, but not the monounsaturated FFA oleate, induces an increase in PUMA mRNA and protein levels. Palmitate induction of PUMA was JNK1-dependent in primary murine hepatocytes. Palmitate-mediated PUMA expression was inhibited by a dominant negative c-Jun, and direct binding of a phosphorylated c-Jun containing the activator protein 1 complex to the PUMA promoter was identified by electrophoretic mobility shift assay and a chromatin immunoprecipitation assay. Short hairpin RNA-targeted knockdown of PUMA attenuated Bax activation, caspase 3/7 activity, and cell death. Similarly, the genetic deficiency of Puma rendered murine hepatocytes resistant to lipoapoptosis. PUMA expression was also increased in liver biopsy specimens from patients with non-alcoholic steatohepatitis as compared with patients with simple steatosis or controls. Collectively, the data implicate JNK1-dependent PUMA expression as a mechanism contributing to hepatocyte lipoapoptosis.

Highlights

Can progress to cirrhosis and hepatocellular carcinoma [3, 4]
A hallmark of the metabolic syndrome, is a major risk factor for NASH and is characterized by an increase in circulating free fatty acids (FFA) [5]. These circulating FFA are transported into hepatocytes by the fatty acid transporter protein 5 and CD36 (6 – 8); within the hepatocyte, these FFA can be esterified to form neutral triglycerides resulting in hepatic steatosis
Activation of the c-Jun N-terminal kinase (JNK) signaling pathway has been implicated as a central mediator of FFA-induced hepatocyte lipoapoptosis in both rodent and human steatohepatitis (16 –18)

Summary

EXPERIMENTAL PROCEDURES

Cells—Huh-7 cells, a human hepatoma cell line, were cultured in Dulbecco’s modified Eagle’s medium containing glucose (25 mM), 100,000 units/liter penicillin, 100 mg/liter streptomycin, and 10% fetal bovine serum. Immunoblot Analysis—Whole cell lysates were prepared as previously described [12], and equal amounts of protein (50 ␮g) were resolved by SDS-PAGE on a 12.5 or 15% acrylamide gel. For the EMSA, 20 ␮g of nuclear proteins were incubated at room temperature for 20 min in binding buffer (25 mM HEPES, pH 7.5, 0.1 M NaCl, 2 mM EDTA, 6% glycerol, 0.1% Triton X-100, 0.1 mM phenylmethylsulfonyl fluoride, 0.4 mM dithiothreitol, 0.5 ␮g/␮l poly(dI-dC), 0.5 ␮g/␮l salmon sperm) with 0.04 pmol of CY 5.5-labeled double-stranded DNA oligonucleotide containing either the wild-type or the mutated putative AP-1 binding sequence within the promoter region or the intronic region of human PUMA gene (Table 2). The entire antibody/protein mixture was incubated with CY 5.5-labeled probe and processed for the gel shift as described above

18 S NOXA PUMA Bad Bid Bik Bmf Hrk

F: AGATTACCTGCATCTCTTGG R: CCCTGCTCTGGTTTGGTGAGT F: GCTCACCAAGTCTGGAGCT R

RESULTS