Abstract
We describe the cloning and analysis of TAF25, a previously uncharacterized yeast gene that encodes a yeast TATA-binding protein-associated factor or yTAF of Mr = 25,000. The gene encoding yTAF25 is a single copy essential gene, and the protein sequence deduced from TAF25 exhibits sequence similarity to a metazoan hTAFII. The results from immunological studies confirm that yTAF25 is a subunit of a large multiprotein TATA-binding protein-yeast TATA-binding protein-associated factor complex that contains a subset of the total number of the yTAFs present in yeast cell extracts. Both genetic and biochemical analyses demonstrate that yTAF25 can interact directly with itself. Transcriptional data show that the activity of the multiprotein complex containing yTAF25 is RNA polymerase II-specific, thus indicating that TAF25 encodes a bona fide yeast RNA polymerase II TAF. Hence the protein encoded by TAF25 has been termed yTAFII25.
Highlights
The TATA-binding protein (TBP)1 is required for transcription by all three eukaryotic nuclear DNA-dependent RNA polymerases (Refs. 1– 4; reviewed in Refs. 5 and 6), where it plays an essential but as of yet incompletely understood role in transcription
We previously reported the use of anti-TBP antibodies for immunoaffinity chromatography to purify TBP1⁄7TAF complexes from yeast whole cell extracts (WCE) [29]
Coimmunoprecipitation and transcriptional studies confirm that yTAF25 is a bona fide TBP-associated factor, that it is a subunit of a multiprotein TBP1⁄7TAF complex, and that its activity is RNA polymerase II-specific
Summary
Protein extracts used for preparative yTAF protein purification via immunoaffinity chromatography were prepared from BJ5457 cells as described [36]. From the determined nondegenerate sequence, an oligonucleotide was designed (GTGAACGATCTCAGTAGCGC) that was used to screen a yeast genomic DNA library (ATCC 77164) to obtain full-length plasmid clones of the gene encoding yTAF25. The resulting amplification product contained 50 base pairs of TAF25 sequences flanking an intact 818-base pair TRP1 gene This DNA fragment (taf25⌬1::TRP1) was gel-purified and used to generate a TAF25 null allele by transforming strain SEY6210.5 to tryptophan prototrophy; the resulting Trpϩ strain was called yEK2. To perform the two-hybrid protein-protein interaction analyses, 5-ml cultures of the desired strain were inoculated from a glycerol stock into selective medium These cultures were grown to an A600 ϭ ϳ0.8/ml, and the cells were used for growth plating assays (data not shown) and for determination of -galactosidase expression levels as described previously [50, 51].
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.